Journal of Threatened Taxa | www.threatenedtaxa.org | 26 May 2025 | 17(5): 26963–26972

 

ISSN 0974-7907 (Online) | ISSN 0974-7893 (Print) 

https://doi.org/10.11609/jott.9040.17.5.26963-26972

#9040 | Received 20 March 2024 | Final received 30 April 2025 | Finally accepted 14 May 2025

 

 

Morphological and molecular identifications of sea turtles Lepidochelys olivacea and Eretmochelys imbricata from the Turtle Bay of Cilacap, Indonesia

 

Chukwudi Michael Ikegwu 1, Agus Nuryanto 2 & M.H. Sastranegara 3       

 

1,2,3 Faculty of Biology, Jenderal Soedirman University, 63 Soeparno Street, Purwokerto 53122, Central Java, Indonesia.

1 Department of Biology, Howard University, 415 College Street Northwest, Washington DC, United States of America.

1 ikegwu.michael@mhs.unsoed.ac.id (corresponding author), 2 agus.nuryanto@unsoed.ac.id, 3 husein@unsoed.ac.id

 

 

Editor: S.R. Ganesh, Kalinga Foundation, Agumbe, India.                Date of publication: 26 May 2025 (online & print)

 

Citation: Ikegwu, C.M., A. Nuryanto & M.H. Sastranegara (2025). Morphological and molecular identifications of sea turtles Lepidochelys olivacea and Eretmochelys imbricata from the Turtle Bay of Cilacap, Indonesia. Journal of Threatened Taxa 17(5): 26963–26972. https://doi.org/10.11609/jott.9040.17.5.26963-26972

  

Copyright: © Ikegwu et al. 2025. Creative Commons Attribution 4.0 International License. JoTT allows unrestricted use, reproduction, and distribution of this article in any medium by providing adequate credit to the author(s) and the source of publication.

 

Funding: Directorate of Research and Community Services, Ministry of Education, Culture, Research and Technology of Indonesia (DIKTI).

 

Competing interests: The authors declare no competing interests.

 

Author details: Chukwudi Ikegwu is a PhD student in the NEGEC Lab, Department of Biology, Howard University, Washington DC. His research focuses on the elevational distribution and diversity patterns and conservation genomics of amphibians and reptiles from the Nigeria-Cameroon montane regions. He holds a distinction in MSc in Biology from Universitas Jenderal Soedirman, Indonesia. Agus Nuryanto obtained his doctoral degree from Bogor Agricultural University through a sandwich program at the University of Bremen, Germany. His research interest includes animal systematics, DNA barcoding, biodiversity, and population genetics. He was promoted as a professor in Animal Taxonomy at the Faculty of Biology, Jenderal Soedirman University, Purwokerto. Moh. Husein Sastranegara  teaches and guides aquatic biota conservation students at the Faculty of Biology, Jenderal Soedirman University, at the undergraduate and postgraduate levels. As the head of an environmental laboratory, he receives analysis services to support activities for the academic community, local government, and the private sector.

 

Author contributions: ICM—field survey, data collection, data analysis, manuscript writing, manuscript review. NA—supervision, funding acquisition, data analysis, manuscript review. SMH—supervision, field survey, data analysis, manuscript review.

 

Acknowledgements: We want to thank the Directorate of Research and Community Services, Ministry of Education, Culture, Research and Technology of Indonesia for funding this study through the Undergraduate Research Program for Master Thesis (Contract: 3.64/UN23.35.5/PT.01/VII/2023) Research grant. The authors are also grateful to the Research and Society Service Institute of the University of Jenderal Soedirman for providing administrative support. The authors also thank all parties who contributed to the fieldwork and collectors from all sampling sites, especially Mr. Juwana, for the assistance rendered.

 

 

Abstract: DNA barcoding is a powerful tool for accurately identifying marine turtle species, especially when morphological identification is challenging, owing to insufficient clues in the samples available. This study focused on two sea turtle samples of dead adults washed ashore and babies hatching out from nests, which pose a challenge for morphological identification. They represented two species, the Olive Ridley Turtle Lepidochelys olivacea and Hawksbill Turtle Eretmochelys imbricata, from Turtle Bay, Cilacap, Indonesia. For one sample, morphological identification initially suggested it as a Green Sea Turtle Chelonia mydas, based on traits like a pair of prefrontal scales, brown carapace colouration, and the absence of serrations on the posterior carapace. The degraded condition of the specimen and shared juvenile traits between C. mydas and E. imbricata made conclusive identification challenging. Using mtDNA barcoding with the CO1 gene provided more accurate species identification, revealing the sample to be E. imbricata with a perfect genetic match in the BLAST search (0% divergence). This result highlights the advantages of molecular approaches when traditional methods fall short. Phylogenetic analysis of L. olivacea and E. imbricata sequences revealed close clustering of sampled sequences with published sequences from Ghana, Australia, and China. High bootstrap values of 92% for L. olivacea and 98% for E. imbricata confirmed the molecular identifications of these samples. The study underscores the value of combining DNA barcoding and phylogenetics for marine turtle identification and evolutionary insights, with implications for conservation and species management.

 

Keywords: Biodiversity, DNA barcoding, dead specimen, % divergence, extraction, genetics, phylogenetic, scutes, taxonomy, threatened.

 

 

 

INTRODUCTION

 

Sea turtles are globally recognized for their ecological importance, with seven species documented worldwide (Robinson & Paladino 2013). Of these, six species inhabit the waters of Indonesia, reflecting the region’s rich biodiversity (Ario et al. 2016). Olive Ridley Sea Turtle Lepidochelys olivacea, Green Sea Turtle Chelonia mydas, Hawksbill Sea Turtle Eretmochelys imbricata, Leatherback Sea Turtle Dermochelys coriacea, Flatback Sea Turtle Natator depressus, and Loggerhead Sea Turtle Caretta caretta are found in Indonesian Waters (Pardede & Yealta 2013; Suraeda et al. 2018). Despite legal protection and their inclusion in Appendix I of the Convention on International Trade in Endangered Species (CITES), illegal trade in sea turtles remains widespread. Transactions often involve parts such as eggs, meat, and shells, complicating taxonomic identification (Nijman & Nekaris 2014; Foran & Ray 2016). One notable site, Turtle Bay in Cilacap Regency, was once iconic for turtle landings but has since been transformed into an industrial and tourist hub, threatening the local turtle populations (Thahira & Wirasmoyo 2022). Although Pertamina (2019) designates the area as a turtle landing site, the lack of sufficient data on sea turtle activity poses a challenge, leaving classification to rely mostly on morphological identification. This study focuses on two species of particular interest: the Olive Ridley Lepidochelys olivacea and the Hawksbill Turtle Eretmochelys imbricata, both of which are critically affected by habitat disruption and illegal trade.

Morphological characteristics and tracks have traditionally been the primary methods for identifying sea turtle species, with traits such as carapace shape, colouration, head and limb structure, track width, and egg size serving as key indicators. Studies like Rupilu et al. (2019) have detailed how features such as the number of costal scutes on the carapace, inframarginal scutes on the plastron, and prefrontal & postocular scales provide essential markers for distinguishing species. In Indonesia, as well as globally, these characteristics have been widely used to identify sea turtles, offering a foundational approach to understanding their development, evolution, and ecological role (van Dam & Diez 1998). Despite its historical significance in biology and paleontology, morphological identification is not without limitations. A major challenge is the risk of misidentification when body parts are degraded or worn out, making it difficult to rely on a limited set of morphological features for accurate identification.

Molecular techniques have become vital in overcoming the limitations of morphology-based species identification, especially in regions like Indonesia, where illegal sea turtle trade complicates classification. Various markers, such as 16S, 12S, CYTB, and ITS, have been used for accurate species identification, with this study focusing specifically on mitochondrial Cytochrome oxidase 1 (CO1). This molecular approach is particularly useful in cases where body parts are traded, as highlighted by Madduppa et al. (2019). Recent studies, including those by Santhosh et al. (2018) and Ollinger et al. (2020), stress the importance of integrating genetic data with morphological analysis to enhance species identification. Molecular methods are not without challenges, such as contamination or incorrect marker usage, which can lead to misidentification. Despite these weaknesses, genetic analysis remains crucial in understanding sea turtle diversity, particularly in areas like Turtle Bay, and Cilacap, where traditional methods fall short.

Sea turtles are threatened wildlife often found dead and decaying on beaches, posing challenges for species identification, critical to conservation intervention. In such cases, DNA barcoding serves as a powerful tool for accurately identifying marine turtle species, particularly when morphological identification is hindered by the lack of sufficient diagnostic traits. This study employed both morphological and genetic analyses to identify sea turtle species in Turtle Bay, Cilacap, Indonesia. Morphological characteristics such as shell structure, curved carapace length, plastron color, and prefrontal scales were assessed alongside genetic data to reduce biases associated with relying solely on physical traits, especially when dealing with deceased & decayed individuals, juveniles, or embryos. Tissue samples from nesting turtles at sites SP1–SP8 were collected for genetic analysis to complement morphological findings. The objective of this research was to accurately identify the species inhabiting the region, integrating both approaches to enhance conservation, and protection efforts.

 

 

METHODS

 

A combination of morphometric data and genetic studies was used to identify the sea turtle species in the study area. For the genetic studies, clutches retrieved from nesting sites were carefully incubated in the sand within the conservation area at Sodong Beach, Cilacap. For the dead and decaying turtle sample, tissue was carefully obtained from the carapace, avoiding contamination. The collected sample was designated unidentified GT for Green Turtle Chelonia mydas and OR1, OR2, and OR3 for Olive Ridley baby turtles and embryo Lepidochelys olivacea. Data collection for this study occurred during the new and full moon (July, August, and September 2023) phases to facilitate taxonomic studies. Tissue samples gathered from the field were preserved at -20 0C and subsequently subjected to analysis at Genetica Science, Indonesia, employing a DNA barcoding protocol.

 

Study area

The study was conducted in Turtle Bay, Cilacap, Indonesia, across a designated area spanning SP1 to SP8, with each station covering a distance of 2 km (Image 1). Cilacap Beach, nestled in Cilacap Regency, Central Java, Indonesia, stretches along the Indian Ocean, offering a serene yet vital coastal landscape. Geographically, it sits at about 7.7300S, 108.9800E, surrounded by a mixture of sandy beaches and coastal hills. Positioned roughly 200 km southwestern of Semarang and 300 km southeastern of Jakarta, the area is more than just a beautiful stretch of coastline. Despite the growing industrial activity, the beach holds immense ecological value as a key nesting ground for sea turtles. This makes it a focal point for conservation efforts, where preserving the natural habitat becomes essential for the survival of these endangered species. Global Positioning Systems (GPS) were utilized to ascertain each station’s research locations and coordinates. The sampling process involved monitoring during the nesting season at eight designated stations (SP1–SP8) with coordinates as follows: SP1 (7.691 0S, 109.181 0E), SP2 (7.691 0S, 109.191 0E), SP3 (7.696 0S, 109.231 0E), SP4 (7.692 0S, 109.244 0E), SP5 (7.698 0S, 109.260 0E), SP6 (7.698 0S, 109.261 0E), SP7 (7.700 0S, 109.292 0E), SP8 (7.700 0S, 109.287 0E).

 

Data collection method

During the nesting season, samples were collected from L. olivacea and E. imbricata. Monitoring of nesting sea turtles occurred during the early morning hours (0200–0600 h.) using rechargeable torchlights. Eggs retrieved from the nesting sites were buried in sandy soils at the conservation area, Sodong Beach, Cilacap, and allowed to hatch. After approximately 45 days (±15 days), samples were obtained from unhatched eggs and deceased hatchlings (Olive Ridley). Additionally, a sample was obtained from a dead adult Hawksbill Sea Turtle E. imbricata carried offshore by ocean currents. They were immersed in a 96% ethanol solution to preserve the samples and stored at -20°C, following established protocols (Roden et al. 2013; Dutton et al. 2014b). The specific methods used to obtain these samples are detailed below.

For the morphological studies, the length and width of the carapace of deceased adult turtles were measured using a measuring tape. Observations were made regarding the number of scutes, carapace colour, shell shape, prefrontal scale, and plastron colour. This information was meticulously recorded in a dedicated research notebook and compared to a reference publication by Pritchard & Mortimer (1999). Genetic studies followed the procedure of using Olive Ridley Lepidochelys olivacea eggs as described below.

Collection tubes filled with 96% ethanol solution were prepared. An unhatched egg was selected and thoroughly rinsed with distilled water. Gloves were worn and changed for each sample collection to prevent contamination. After drying the eggshell with a tissue and placing it in a petri dish, an ethanol swab was used for additional cleaning. Using forceps to grasp a part of the egg, the shell was gently opened with sterile scissors. The embryo was carefully collected, transferred to sample collection tubes, and securely sealed using a wooden skewer. The samples were  labelled using a pencil. The containers were wrapped and stored in a cool, dry place until they were later transported to the Animal Taxonomy Laboratory in a cooler with ice. Subsequently, they were stored at -20 °C for the next stage of the process.

Table 2 outlines the protocol optimization based on the methods described by Madduppa et al. (2019), with modifications to the extraction and amplification procedures. In the study involving dead Olive Ridley baby turtles, embryo, and Hawksbill Sea Turtles (initially labelled as GT sample, unverified specimen), gloves were worn and changed for each sample collection. The rear end of the flipper was cleaned with an ethanol swab. A small section of the hind flipper was carefully cut using forceps with sterile scissors. The sample was then transferred into a plastic vial filled with ethanol using a wooden skewer. The samples were labelled using a pencil. The containers were wrapped and stored in a cool, dry place until later transported to the Animal Taxonomy Laboratory at the Faculty of Biology, UNSOED, in a cooler with ice. Subsequently, the samples were stored at -20°C for the next stage of the process as described below.

DNA Barcoding was conducted at Genetica Science, Indonesia, using CO1 gene to identify the sea turtle species. The Genomic DNA Extraction was done using the Quick-DNA™ Tissue/Insect Miniprep kit (ZYMO, D6016) following the manufacturer’s protocol. A 50 mg tissue sample was added to a ZR BashingBead™ Lysis Tube (2.0 mm). Then, 750 µl of BashingBead™ buffer was added to the tube and tightly capped. It was secured in a bead beater fitted with a 2 ml tube holder assembly and processed at maximum speed for 10 min. The ZR BashingBead™ Lysis Tube (2.0 mm) was centrifuged in a microcentrifuge at ≥10,000 x g for one min. Subsequently, 400 µl of the supernatant was transferred to a Zymo-Spin™ III-F filter in a collection tube and centrifuged at 8,000 x g for 1 min. Then, 1,200 µl of genomic lysis buffer was added to the filtrate in the collection tube, and the mixture was thoroughly mixed. Further, 800 µl of the mixture from the previous step was transferred to a Zymo-Spin™ IICR Column one in a collection tube and centrifuged at 10,000 x g for 1 min. The eluate from the collection tube was discarded, and the procedure was reiterated.

Subsequently, 200 µl of DNA pre-wash buffer was introduced to the Zymo-Spin™ IICR column within a fresh collection tube and subjected to centrifugation at 10,000 x g for 1 min. Following this, 500 µl of g-DNA Wash Buffer was applied to the Zymo-Spin™ IICR Column, followed by centrifugation at 10,000 x g for 1 min. Ultimately, the Zymo-Spin™ IICR column was relocated to a sterile 1.5 ml microcentrifuge tube, and 100 µl (with a minimum requirement of 35 µl) of DNA elution buffer was directly administered to the column matrix. The column was  centrifuged at 10,000 x g for 30 s to facilitate DNA elution (ZYMO Research Manual 2021).

PCR was performed in a 25 µL reaction volume consisting of 1 µL template DNA, 12.5 µL MyTaq HS Red Mix 2X, and 1.0 µL of each of the four primers (10 µM), 7.5 µL of ddH₂O, and the conditions were set as seen in Table 1. The four primer sequences used were as follows:

VF2_t1: TGTAAAACGACGGCCAGTCAACCAACCACAAAGA CATTGGCAC

FishF2_t1: TGTAAAACGACGGCCAGTCGACTAATCATAAAG ATATCGGCAC

FishR2_t1: CAGGAAACAGCTATGACACTTCAGGGTGACCG AAGAATCAGAA

FR1d_t1: CAGGAAACAGCTATGACACCTCAGGGTGTCCGA ARAAYCARAA

 

Data analysis

Species identification followed the reference guidelines provided by Pritchard & Mortimer (1999). Sequences obtained were analyzed using the BOLD system and GenBank databases to confirm species identity, and similarity. Forward and reverse primer sequences were assembled into contigs, creating a single sequence for each sample. These sequences were subjected to a BLAST search on GenBank to identify species. They were also submitted to the NCBI database, where they were assigned the following GenBank accession numbers: OR1 (OR562509.1 and 627 bp), OR2 (OR562510.1, and 648 bp), OR3 (OR562511.1, and 656 bp), and GT (OR562508.1, and 648 bp). The BIN for each closest-matching species was retrieved from BOLD, with OR1, OR2, and OR3 Lepidochelys olivacea assigned BIN AAC1248, and GT Eretmochelys imbricata assigned BIN ACE8206 (pending compliance with metadata requirements).

In addition, sequences from 10 individuals of Lepidochelys olivacea, 10 individuals of Eretmochelys imbricata, and seven individuals of Lepidochelys kempii were downloaded from BOLD to construct a phylogenetic tree with the sequences from the study. Sequences were concatenated and edited to remove stop codons. One sequence of Dermochelys coriacea was used as the outgroup tree was built using the Neighbor-Joining method in MEGA, illustrating the phylogenetic relationships of species inhabiting Turtle Bay of Cilacap. The results were then discussed for further insights into species positioning.

 

 

Results

 

Of the eight sampling sites surveyed, eggs were found in four areas (Table 3). The number of clutches retrieved from one nest in a sampling site within the study area ranged between 30 (SP8) and 100 (SP3). These data cannot be used to quantify species identity due to irregularities caused by constant poaching prior to egg retrieval. Eggs were recovered from SP1, SP3, SP7, and SP8, with SP8 having the highest number of clutches (Figure 1). At SP7, nesting was also observed twice, but no eggs were found despite visible turtle tracks (noted as NA), indicating poaching. Figure 1 provides a chart representation of egg retrievals across the sampling stations (SP1–SP8), where four sites had no egg records.

A single dead turtle (Image 2) was labelled as “GT” due to certain features, including a brownish plastron colour, absence of strong or prominent serrations, and a pair of prefrontal scales (Table 4). The morphological data for the OR samples, derived from two deceased baby turtles (Image 2), are also presented in Table 4. These data indicated 5–7 costal scutes, grey carapace colouration, slightly overlapping carapace shape, four prefrontal scales, and a white plastron.

Due to the juvenile stage of the specimens, DNA barcoding was employed to confirm the species identity of these two OR samples apart from the decayed GT sample. Similarity and identity results from BOLD Systems and GenBank are presented in Table 5. Both Eretmochelys imbricata and Lepidochelys olivacea showed a 100% similarity (0% divergence) to reference sequences, signifying high confidence in species identification. Taxonomic identities, including taxon assignment, and associated probabilities for the two species identified in Turtle Bay, Cilacap, are summarized in Table 6.

 

 

DISCUSSION

 

This study utilized a combination of fieldwork for data collection and wet lab experiments. The morphological aspect of the study involved a series of body measurements and observations. As shown in Table 4, morphometric characters were collected and compared with data from previous studies. Morphological identification involved body measurements and observations based on the guidelines of Pritchard & Mortimer (1999). In Olive ridley, (OR samples), morpho-data were obtained from baby turtles. The recoded costal scutes were 5–7, grey colouration, slightly overlapping carapace, two pairs of prefrontal scales, and white plastron colour. It’s morphometrics were consistent with Pritchard & Mortimer (1999), who reported 6–9 costal scutes in L. olivacea (with occasional occurrences of five in hatchlings), two pairs of prefrontal scales, and a slightly overlapping carapace in juveniles.

For the GT sample, which was a dead and decayed specimen with degraded body parts, morphological identification proved challenging. Initially, the sample was tentatively identified as Chelonia mydas due to certain features such as the presence of four costal scutes—a trait shared by both Green and Hawksbill Turtles. Additionally, the measured curved carapace length (CCL) was 66 cm, classifying the specimen as juvenile, since C. mydas & E. imbricata reach sexual maturity at >85 cm, and 78.8 cm CCL, respectively (Liles et al. 2011; Zárate et al. 2013  ). The juvenile state complicated the classification as either C. mydas or E. imbricata based solely on CCL data. Most external morphological characteristics aligned with those of C. mydas, despite the initial uncertainty. These included the presence of a pair of prefrontal scales, which is a distinguishing feature of Green Turtles compared to Hawksbill Turtles. The observed specimen had a pair of prefrontal scales, supporting its tentative classification as a Green Turtle. Regarding plastron colour, the remaining intact parts were brown, consistent with Pritchard & Mortimer’s (1999) description of immature C. mydas as having brown colouration with radiating streaks. This characteristic varies significantly in adults, ranging from plain to streaked or spotted in shades of brown, buff, or other earth tones, further supporting the identification as C. mydas.

In terms of carapace shape, both Green and Hawksbill Turtles have an oval carapace. In contrast, Hawksbill Turtles possess strongly serrated posterior margins, whereas Green Turtles have a broadly oval, non-serrated carapace. The observed carapace lacked prominent serrations, but given the specimen’s degraded condition, it is possible that the absence of strong serrations resulted from damage, complicating definitive identification. Overall, while the morphological evidence pointed toward C. mydas, the degraded state of the specimen and overlapping characteristics with E. imbricata highlighted the challenges of relying solely on morphological identification.

In contrast, molecular analysis provided more definitive results. Tissue samples were collected following the protocols of Dutton (1996) and Carreras et al. (2007)   for DNA extraction and amplification (Table 2). The CO1 mitochondrial DNA gene was used for species identification through DNA barcoding, a method praised for its precision, and wide applicability (Madduppa et al. 2019). DNA barcoding allowed for accurate species identification even in the absence of complete morphological data, as demonstrated by Abreu-Grobois et al. (2006). This method has been successfully applied across various taxa, including fish larvae (Nuryanto et al. 2023a), fish from family Sparidae (Nuryanto et al. 2023b), Antarctic Fish (Belchier & Lawson 2013), and sea turtles (Bahri et al. 2017). Furthermore, Hernandez et al. (2013) supported taxonomic sufficiency at the genus level for analyzing assemblage diversity.

For the GT sample, DNA barcoding contradicted the initial morphological identification. While certain morphological characters initially suggested it was Chelonia mydas, the genetic analysis revealed it to be Eretmochelys imbricata, as confirmed by a 100% (0% divergence) match in the BLAST search, although the BIN (ACE8206) on BOLD is still undergoing metadata validation. This outcome demonstrates the advantages of molecular approaches over traditional methods, particularly when morphological data is incomplete or unreliable. Additionally, studies such as those by Pereira et al. (2013), Lim et al. (2016), Briñoccoli et al. (2020), and Mohammed-Geba et al. (2021) have shown that intraspecific genetic similarities ranging from 92.5% to 99% can serve as species borders in various research contexts (Nuryanto et al. 2017; Winarni et al. 2023). Čandek & Kurtner (2015) further emphasized the importance of geographic locality information for accurate species delineation.

The CO1 target was used in this study to assess the similarity and identity of sea turtles in Turtle Bay, Cilacap. Amplification of two tissues (two baby turtles), an embryo for OR, and tissue from an unidentified GT, from different individuals yielded 100% similarity (0% divergence) to CO1 sequences in BOLD Systems and GenBank for L. olivacea, and from one tissue yielded E. imbricata (Table 5). Nuryanto et al. (2023) reported that 99% genetic similarity is a reliable species delineation threshold, consistent with findings from other studies (Ratnasingham & Hebert 2013; Nuryanto et al. 2018; Amatya 2019; Kusbiyanto et al. 2020).

In the context of phylogenetic studies, Yang & Rannala (2010) revealed that phylogenetic analysis employs molecular techniques to identify and analyze the connections among closely related species in systematics and taxonomy. The current study provides a phylogenetic overview of Lepidochelys olivacea and Eretmochelys imbricata found in Indonesia. The phylogeny was largely consistent with other marine phylogenies (Bowen et al. 1993; Dutton et al. 1996). Phylogenetic analysis, supported by high bootstrap values, clearly showed that all sequences of L. olivacea obtained in Indonesia could be grouped into a single genetic lineage. Specifically, OR1, OR2, and OR3 identified as L. olivacea clustered with sequences BENT083-08, BENT084-08, and BENT082-08 from Ghana, as well as BENT081-08, BENT079-08, BENT077-08, BENT075-08, BENT078-08, and BENT076-08 from Australia, achieving a bootstrap value of 92%. At the larger clade level, the bootstrap support is 100%. Meanwhile, for GT, the sequence in the present study falls within a well-supported Eretmochelys imbricata clade, with a 91.1% bootstrap value for its subclade, indicating strong support, while another subclade within E. imbricata from BOLD has 96.1% support. The larger E. imbricata clade is highly supported at 100%. Additionally, the sequence in the present study forms a sister species relationship with GBGCR1900-18 from Chinese waters, with a strong bootstrap support of 98.3%, highlighting their close genetic similarity.

For L. olivacea, despite being from different geographical locations, the clustering in a single clade implies low genetic divergence, indicating a close evolutionary relationship. This suggests divergence from a common recent ancestor, even though they are separated by distance. The single individual sequenced from Indonesia identified as E. imbricata also clustered with a species from China, further implying low genetic divergence.

Despite the findings, there may be limitations in this study due to the restricted number of morpho-characters analyzed and the limited data available to demonstrate the complete relationship of E. imbricata with other species, as only one individual was identified. This study contributes to systematic biology by demonstrating the importance of integrating morphological and molecular techniques for species identification, particularly in cases where morphological data alone are insufficient. By using DNA barcoding alongside traditional morphological methods, the research highlights how molecular tools, such as the CO1 gene, can provide more precise identification of species, addressing the limitations of morphology-based approaches. The identification of Eretmochelys imbricata through genetic analysis, despite initial misclassification based on morphology, underscores the growing need for molecular methods in systematics.

 

Table 1. PCR Conditions details used in the present study.

Steps

Temperature 0C

Time

Cycles

Initial denaturation

95

3 min

1

Denaturation

Annealing

Extension

95

50

72

15 sec

30 sec

45 sec

 

35

Final extension

72

3 min

1

Hold

4

∞

1

 

 

Table 2. Protocol optimization for tissue sampling following Maduppa et al. (2019).

 

Tissue type

Tissue sampling

Preservation

Extraction

Amplification

1

Dead baby turtle

 rear-flipper

96% ethanol

ZYMO, D6016

Bioline, BIO-25048

2

Dead GT turtle

 Flipper

96% ethanol

ZYMO, D6016

Bioline, BIO-25048

3

Egg Clutches

 Embryo

96% ethanol

ZYMO, D6016

Bioline, BIO-25048

 

 

Table 3. Number of sea turtle egg clutches retrieved from the study locations.

 

Code

Sampling site

Date (found)

Eggs

1

SP1

Sodong

July 2

65

2

SP2

Srandil

 -

-

3

SP3

Welahan Wetan

Aug. 21

100

4

Sp4

Widarapayung Kulon

 -

-

5

Sp5

Sidayu

 -

-

6

Sp6

Widarapayung Wetan

 -

-

7

Sp7

Sidaurip

July 9, 11

NA, 96

8

Sp8

Pagubugan

July 7

30, 80

The eggs were retrieved from SP1, SP6, SP7, and SP8, respectively.

 

 

Table 4. Morphological identification of samples of a dead turtle (GT sample) and baby turtles (OR) sourced from the study area.

 

Features

GT Sample

OR (baby turtles)

1

Costal scutes

4

5–7

2

Carapace color

Brown

Grey

3

Carapace length CCL

66 cm

-

4

Carapace width CCW

57 cm

-

5

Carapace shape

Oval

Slightly overlapping

6

Prefrontal scales

2

4

7

Plastron

White

White

 

 

Table 5. Similarity (BOLDsystems) and identity (GenBank) -----and accession number details.

 

Sample Initial

Similarity %

Identity %

Reference Species

 

1

GT

100

100

100

100

100

100

100

100

Eretmochelys imbricata JX454970

E. imbricata GQ152886

E. imbricata KU254594

E. imbricata KP221806

2

OR1

100

100

100

100

100

100

100

100

Lepidochelys olivacea JX45991

L. olivacea NC_028634

L. olivacea JX454979

L. olivacea JX454987

3

OR2

100

100

100

100

100

100

100

100

L. olivacea JX454991

L. olivacea NC_028634

L. olivacea JX454979

L. olivacea JX454987

4

OR3

100

100

100

100

100

100

100

100

L. olivacea JX454991

L. olivacea NC_028634

L. olivacea JX454979

L. olivacea JX454987

 

 

Table 6. Identification summary for Eretmochelys imbricata and Lepidochelys olivacea.

 

Linnaean rank

Eretmochelys sp.

Lepidochelys sp.

Probability %

1

Phylum

Chordata

Chordata

100

2

Class

Reptilia

Reptilia

100

3

Order

Testudines

Testudines

100

4

Family

Cheloniidae

Chelonidae

100

5

Genus

Eretmochelys

Lepidochelys

100

6

Species

Eretmochelys imbricata

Lepidochelys olivacea

100

 

 

For figures & images - - click here for full PDF

 

 

References

 

Abreu-Grobois, F.A., J. Horrocks & A. Formia (2006). New mtDNA D-loop primers, which work for various marine turtle species, may increase the resolution capacity of mixed stock analysis. Proceedings of the 26th Annual Symposium on Sea Turtle Biology and Conservation hel in Crete, Greece 2–8 April 2006.

Amatya, B. (2019). DNA barcoding of cyprinid fish Chagunius chagunio Hamilton, 1822 from Phewa Lake, Nepal. International Journal of Biology 11(4): 88–100. https://doi.org/10.5539/ijb.v11n4p88

Ario, R., E. Wibowo, I. Pratikto & S. Fajar (2016). Pelestarian habitat penyu dari ancama kepunahan di Turtle Conservation and Education Center (TCEC), Bali. Jurnal Kelautan Tropis 19(1): 60–66.

Bahri, S., A.S. Atmadipoera & H.H. Madduppa (2017). Genetic diversity of Olive Ridley Lepidochelys olivacea associated with current pattern in Cendrawasih Bay, Papua. Jurnal Ilmu dan Teknologi Kelautan Tropis 9: 747–760. https://doi.org/10.29244/jitkt.v9i2.19307  

Belchier, M. & J. Lawson (2013). An analysis of temporal variability in abundance, diversity, and growth rates within the coastal ichthyoplankton assemblage of south Georgia (sub Antarctic). Polar Biology 36: 969–983. https://doi.org/10.1007/s00300-013-1321-9  

Bowen, B.W., W.S. Nelson & J.C. Avise (1993). A molecular phylogeny for marine turtles: trait mapping, rate assessment, and conservation relevance. Proceedings of the National Academy of Sciences of the United States of America 90(12): 5574–5577. https://doi.org/10.1073/pnas.90.12.5574

Briñoccoli, Y.F., G.G. Garrido & A. Alvarez (2020). DNA barcoding identifies three species of croakers (Pisces, Sciaenidae) in the ichthyoplankton of the high Paraná River. Academia Brasileira de Ciências 92(1): e20180783. https://doi.org/10.1590/0001-3765202020180783  

Čandek, K. & M. Kuntner (2015). DNA barcoding gap: reliable species identification over morphological and geographical scales. Molecular Ecology Resources 15(2): 268–277. https://doi.org/10.1111/1755-0998.12304  

Carreras, C., M. Pascal, L. Cardona, A. Aguilar, D. Margaritoulis, A. Rees, O. Turkozan, Y. Levy, A. Gasith, M. Aureggi & M. Khalil (2007). The genetic structure of the Loggerhead Sea Turtle Caretta caretta in the Mediterranean as revealed by nuclear and mitochondrial DNA and its conservation implications. Conservation Genetics 8: 761–775. https://doi.org/10.1007/s10592-006-9224-8

Dutton, P.H. (1996). Methods for collection and preservation of samples for sea turtle genetic studies. pp. 17–24. In: Bowen, B.W. & W.N. Witzell (eds.). Proceedings of the International Symposium on Sea Turtle Genetics. NOAA Technical Memorandum NMFS-SEFSC-396, 173 pp.

Dutton, P.H., M.P. Jensen, K. Frutchey, A. Frey, E. LaCasella, G.H. Balazs, J. Cruce, A. Tagarino, R. Farman & M. Tatarata (2014b). Genetic stock structure of Green Turtle (Chelonia mydas) nesting populations across the Pacific islands. Pacific Science 68(4): 451–464. https://doi.org/10.2984/68.4.1

Foran, D.R. & R.L. Ray (2016). Mitochondrial DNA profiling of illegal tortoiseshell products derived from Hawksbill Sea Turtles. Journal of Forensic Science 61(4): 1062–1066. https://doi.org/10.1111/1556-4029.13062

Hernandez, Jr. F.J., L. Carassou, W.M. Graham & S.P. Powers (2013). Evaluation of the taxonomic sufficiency approach for ichthyoplankton community analysis. Marine Ecology Progress Series 491: 77–90. https://doi.org/10.3354/meps10475

Kusbiyanto, D. Bhagawati & A. Nuryanto (2020). DNA barcoding of crustacean larvae in Segara Anakan, Cilacap, central Java, Indonesia using cytochrome c oxidase gene. Biodiversitas 21(10): 4878–4887. https://doi.org/10.13057/biodiv/d211054

Liles, M.J., M.V. Jandres, W.A. López, G.I. Mariona, C.R. Hasbún & J.A. Seminoff (2011). Hawksbill turtles Eretmochelys imbricata in El Salvador: nesting distribution and mortality at the largest remaining nesting aggregation in the eastern Pacific Ocean. Endangered Species Research 14(1): 23–30. https://doi.org/10.3354/esr00338  

Lim, H.C., M.Z. Abidin, C.P. Pulungan, M. de Bryun, & S.A.M. Nor (2016). DNA barcoding reveals high cryptic diversity of the freshwater halfbeak Genus Hemirhamphodon from Sundaland. PLoS ONE 11(9): e0163596. https://doi.org/10.1371/journal.pone.0163596

Madduppa, H.H., S. Bahri, B. Subhan, N.P. Anggraini, H. Ohoiulun, T. Abdillah, D. Arafat, P. Santoso & I.M. Sangadji (2019). DNA barcoding of sea turtles (Dermochelyidae and Cheloniidae) and its protocol using different tissue quality: implication to conservation managers. Earth and Environmental Science 278(1): 20–41. https://doi.org/10.1088/1755-1315/278/1/012041  

Mohammed-Geba, K., A. Yousif, A.M. Younis & A. Harby-Rashed (2021). DNA barcoding and molecular phylogeny confirm the presence of the cryptic Penaeus japonicas Form II (P. pulchricaudatus) in the Egyptian demersal fisheries of the Gulf of Suez and the Bitter Lakes. Egypt Journal of Aquatic Biology and Fisheries 25: 615–627. https://doi.org/10.21608/ejabf.2021.192469  

Nijman, V. & K.A.I. Nekaris (2014). Trade in wildlife in Bali, Indonesia, for medicinal and decorative purposes. TRAFFIC Bull 26(1): 31–36.

Nuryanto, A., H. Pramono, M.H. Sastranegara (2017). Molecular identification of fish larvae from East Plawangan of Segara Anakan, Cilacap, central Java, Indonesia. Biosaintifika: Journal of Biology & Biology Education 9(1): 33–40. https://doi.org/10.15294/biosaintifika.v9i1.9191  

Nuryanto, A., H. Pramono, Kusbiyanto, M.I. Ghifari & N. Andareswari (2018). Barcoding of fin clip samples revealed high exploitation of Plectropomus leopardus in the Spermonde Archipelago. Biosaintifika: Journal of Biology & Biology Education 10(3): 629–635. https://doi.org/10.15294/biosaintifika.v10i3.16142  

Nuryanto, A., D. Bhagawati & A.A. Rofiqoh (2023). Barcoding of Sparidae collected during east monsoon season in the eastern Indian Ocean south of Java, Indonesia. AACL Bioflux 16(2): 805–817.

Nuryanto, A., D. Bhagawati, E.T. Winarni & H.H.A. Mahmoud (2023a). First Record Sparus aurata Larvae in Teluk Penyu Beach Cilacap, Indonesia, revealed by DNA Barcoding. Indonesian Journal of Marine Science 28(4): 301–312. https://doi.org/10.14710/ik.ijms.28.4.301-312  

Nuryanto, A., D. Bhagawati, E.T. Winarni & A.R. Andriasari (2023b). First record of red seabream, Pagrus major existence in the eastern Indian Ocean south of Java, Indonesia revealed by DNA barcoding. Biodiversitas 24: 6023–6030. https://doi.org/10.13057/biodiv/d241123

Ollinger, N., V. Lasinger, C. Probst, J. Pitsch, M. Sulyok, R. Krska & J. Weghuber (2020). DNA barcoding for the identification of mold species in bakery plants and products. Food Chemistry 318: 126501. https://doi.org/10.1016/j.foodchem.2020.126501

Pardede, M.T. & D. Yealta (2013). Upaya World Wide Fund for Nature (WWF) dalam mengatasi perdagangan penyu ilegal di Provinsi Bali Tahun 2008–2013. Jurnal Online Mahasiswa Fakultas Perikanan Dan Ilmu Kelautan Universitas Riau 2(2): 2–5.

Pereira, L.H.G., R. Hanner, F. Foresti & C. Olivera (2013). Can DNA barcoding accurately discriminate megadiverse Neotropical freshwater fish fauna? BMC Genetics 14: 20. https://doi.org/10.1186/1471-2156-14-20

Pertamina (2019). Pertamina supports Turtle Conservation on the South Coast Cilacap Pertamina. https://www.pertamina.com/Id/news-room/csr-news/pertamina-dukungkonservasi-penyu-di-pesisir-selatan-cilacap. Accessed on 22 February 2024).

Pritchard, P.C.H. & J.A. Mortimer (1999). Taxonomy, external morphology, and species identification. pp. 21–38. In: Eckert, K.L., K.A. Bjorndal, F.A. Abreu-Grobois & M. Donnelly (eds.). Research and Management Techniques for the Conservation of Sea Turtles. IUCN/SSC Marine Turtle Specialist Group Publication No. 4. Washington, DC.

Ratnasingham, S. & P.D.N. Hebert (2013). A DNA-based registry for all animal species: The Barcode Index Number (BIN) system. PLoS ONE 8(7): e66213. https://doi.org/10.1371/journal.pone.0066213

Robinson N.J. & F.V. Paladino (2013). Sea turtles, reference module in earth systems and environmental sciences. Elsevier 2013: 1–14. https://doi.org/10.1016/B978-0-12-409548-9.04352-9

Roden, S.E., P.A. Morin, A. Frey, G.H. Balazs, P. Zárate, I.-J. Cheng & P.H. Dutton (2013). Green turtle population structure in the Pacific: new insights from single nucleotide polymorphisms and microsatellites. Endangered Species Research 20: 227–234. https://doi.org/10.3354/esr00500

Rupilu, K., J. Fendjalang & D. Prayer (2019). Species identification and spawning of sea turtle at Meti Island North Halmahera Regency. IOP Conference Series Earth and Environmental Science 339(1): 012034

Santhosh, K.J.U., V. Krishna, G.S. Seethapathy, R. Ganesan, G. Ravikanth & R.U. Shaanker (2018). Assessment of adulteration in raw herbal trade of important medicinal plants of India using DNA barcoding. Biotech 8(3): 135. https://doi.org/10.1007/s13205-018-1169-3  

Suraeda, R.Y., S. Sunaryo & E.W. Kushartono (2018). Laju pertumbuhan spesifik Tukik Penyu Lekang Lepidochelys olivacea dengan pemberian pakan buatan yang berbeda di Turtle Conservation and Education Center, Bali. Journal of Marine Research 7(3): 185–192.

Thahira, A.R. & W. Wirasmoyo (2022). Application of ecological architecture concept to the sea turtle sanctuary and education center in Cilacap Regency. Jurnal Arsitektur Zonasi 5(2): 431–432. https://doi.org//10.17509/jaz.v5i2.41444

van Dam, R.P. & C.E. Diez (1998). Home range of immature Hawksbill Turtles Eretmochelys imbricata (Linnaeus) at two Caribbean Islands. Journal of Experimental Marine Biology and Ecology 220: 15–24.

Winarni, E.T., S.B.I. Simanjuntak & A. Nuryanto (2023). DNA barcoding of crustacean larvae with two new records of Caridina gracilipes and Ptychognathus altimanus in the western region of Segara Anakan lagoon in Indonesia. Biodiversitas 24(1): 341–348. https://doi.org/10.13057/biodiv/d240141

Yang, Z. & B. Rannala (2010). Bayesian species delimitation using multilocus sequence data. Proceedings of the National Academy of Sciences 107(20): 8843–8848. https://doi.org/10.1073/pnas.0913022107 

Zárate, P., K.A. Bjorndal, M. Parra, P.H. Dutton, J.A. Seminoff & A.B. Bolten (2013). Hatching and emergence success in Green Turtle (Chelonia mydas) nests in the Galápagos Islands. Aquatic Biology 19(3): 217–229. https://doi.org/10.3354/ab00534

ZYMO Research Instruction Manual (2021). Quick-DNA™ Tissue/Insect Miniprep Kit Catalog, No. D6016. www.zymoresearch.com