Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2025 | 17(3): 26571–26586

ISSN 0974-7907 (Online) | ISSN 0974-7893 (Print)

https://doi.org/10.11609/jott.8364.17.3.26571-26586

#8364 | Received 11 January 2023 | Final received 29 January 2025 | Finally accepted 14 February 2025

Dasymaschalon leilamericanum (Annonaceae), a new species with evidence of non-monophyly from Mount Lantoy Key Biodiversity Area, Philippines

Raamah Rosales ¹ , Edgardo Lillo ² , Archiebald Baltazar Malaki ³ , Steve Michael Alcazar ⁴ ,

Bernardo Redoblado ⁵ , John Lou Diaz ⁶ , Inocencio Buot Jr. ⁷ , Richard Parilla ⁸ & Jessica Rey ⁹

¹ College of Arts and Sciences, Cebu Technological University-Main Campus, Cebu City, Philippines.

^2,3,4,5,6 Cebu Technological University-Argao Campus, Cebu, Philippines.

⁷ Forest Biological Sciences, College of Forestry and Natural Resources, University of the Philippines, Los Baños, Laguna, Philippines.

⁸ Division of Natural Science and Mathematics, University of the Philippines - Tacloban College, Leyte, Philippines.

⁹ Institute of Biological Science, College of Arts and Sciences, University of the Philippines, Los Baños, Laguna, Philippines.

¹ raamah.rosales@ctu.edu.ph (corresponding author), ² edgardo.lillo@ctu.edu.ph,³ archlam68@gmail.com, ⁴ alcazarstevemichael@gmail.com, ⁵ bnad7@gmail.com, ⁶ diazjohnlou@gmail.com, ⁷ iebuot@up.edu.ph, ⁸ rbparilla@up.edu.ph, ⁹ jdrey@up.edu.ph

Editor: Mandar Paingankar, Government Science College Gadchiroli, Maharashtra, India. Date of publication: 26 March 2025 (online & print)

Citation: Rosales, R., E. Lillo, A.B. Malaki, S.M. Alcazar, B. Redoblado, J.L. Diaz, I. Buot Jr., R. Parilla & J. Rey (2025). Dasymaschalon leilamericanum (Annonaceae), a new species with evidence of non-monophyly from Mount Lantoy Key Biodiversity Area, Philippines. Journal of Threatened Taxa 17(3): 26571–26586. https://doi.org/10.11609/jott.8364.17.3.26571-26586

Copyright: © Rosales et al. 2025. Creative Commons Attribution 4.0 International License. JoTT allows unrestricted use, reproduction, and distribution of this article in any medium by providing adequate credit to the author(s) and the source of publication.

Funding: Department of Science and Technology – Philippine Council for Agriculture, Aquatic and Natural Resources Research and Development (DOST-PCAARRD);

Cebu Technological University (CTU)

Competing interests: The authors declare no competing interests.

Author details: Raamah Rosales, holds a PhD degree in biology and is the project leader of the study on DNA Barcoding of endemic flora in Cebu Island, Philippines. His focus of research is on biology conservation and ecosystem resiliency. Dr. Edgardo Lillo is a licensed forester who has extensive study on Philippine flora. Dr. Archiebald Baltazar Malaki is the program leader of the flora and fauna assessment in Cebu Island. Dr. Steve Michael Alcazar is involved on Cebu Island conservation and passionate about plant-animal interaction. Mr. Bernardo Redoblado is a licensed forester and involved in many biodiversity assessment projects. Mr. John Lou Diaz is also a forester and assisted several biodiversity assessment in the island. Dr. Inocencio Buot Jr. is a highly respected researcher whose expertise include taxonomy, plant biology, and ecosystem management. Dr. Richard Parilla is an expert in DNA barcoding and involved in conservation projects on flora and fauna in neighboring islands. Dr. Jessica Rey is a widely published researcher with studies on molecular analyses on plant taxonomy, diseases, and gene expression.

Author contributions: RR—project leader, molecular analysis and paper writing; EL—data collection, morphological analysis and paper writing; ABM—guidance in research methodology; SMA—guidance in data collection; BR—specimen collection and morphological analysis; JLD—specimen collection and morphological analysis; IBJr.—guidance in research methodology; RP—molecular analysis and paper writing; JR—DNA extraction, molecular analysis

Acknowledgements: The authors would like to acknowledge the Department of Science and Technology (DOST) for considering and approving our research proposal and giving us the budget for three years, enough for the implementation of the whole study, and declaring CTU as one of the DOST–Biodiversity Centers through the NICER program in Region 7. The Philippine Council for Agriculture and Aquatic Resources Research Development (PCAARRD) favorably recommended our proposal to DOST and guided us in the implementation of the study, assisted us in the report preparation, and writing. The National Research Council of the Philippines (NRCP) of DOST provided expert assistance through its RD LEAD program. The CTU System supported the research team all the way. The Bachelor of Science in Forestry (BSF 1) students who assist in the collection of voucher specimens. Cherelyn Davirao, Renante Getaruelas, and Beatrice Nicole Cagara and BSF 2 students who help in the characterization of species. The molecular laboratory staff of UP Diliman-Institute of Biology, Charles Anthon Cardona, for helping in the DNA extraction and PCR Analysis of the plant samples. The Philippine Genome Center-Mindanao for its assistance in the phylogenetic analysis.

Abstract: A new Annonaceae species, Dasymaschalon leilamericanum is described from Mount Lantoy Key Biodiversity Area (KBA) in the Municipality of Argao, Cebu, Philippines. D. leilamericanum is distinguished from closely related species by morphological characters including laminar size, leaf areolation, and seed/fruit shape and size. Significant differences observed in a multivariate analysis of morphological data for D. leilamericanum, D. clusiflorum, D. filipes, D. ellipticum, and D. blumei indicate D. leilamericanum is a distinct species. A phylogenetic tree analysis performed using maturase K (matK) and ribulose 1,5-biphosphate carboxylase (rbcL) as molecular markers failed to match D. leilamericanum with other Dasymaschalon species. Taken together, the results of morphological and molecular analysis indicate a unique evolutionary pathway for D. leilamericanum with its genus.

Keywords: Conservation, Cebu Island, evolutionary, forest, limestone, multivariate, non-monophy, plant, paraphyletic, phylogenetic, sedimentary, shrub.

INTRODUCTION

The forest of Cebu island in the Philippines, is home to several endemic species of flora and fauna (Cadiz & Buot 2010; Rosales et al. 2020). Several of the endemic species growing in this area are threatened due to deforestation and continued human pressure (Lillo et al. 2019, 2020, 2021). The forest fragments of Mount Lantoy Key Biodiversity Area (KBA) in Argao, Cebu, listed two Critically Endangered, two Endangered, four Vulnerable, and 16 restricted-range species (CI/DENR-PAWB/Haribon 2006). The Tabunan forest of the Central Cebu Protected Landscape (CCPL) is the largest forest fragment with an area of 40 ha. The Tabunan forest is home to the endemic Cinnamomum cebuense Kosterm and among the threatened species in spite its distribution range is within the protected landscape (Quimio 2006).

The genus Dasymaschalon is classified under the order Magnoliales of the family Annonaceae. It was initially considered to be a part of section Unona auct. non L. (Hooker & Thompson 1855). Dasymaschalon was classified as a section of Desmos Loureiro’s (1790:352) Desmos sect by Hooker & Thomson (1855:134) and Safford (1912:507) Saff, Dasymaschalon (1912:507) (e.g. Sinclair 1955; Maxwell 1989; Li 1993). Many taxonomists such as Finet & Gagnepain (1906), Merrill (1915), Hutchinson (1923), Fries (1959), Bân (1975), Klucking (1986), Van Heusden (1992), Kebler (1993), Koek-Noorman et al. (1997), Sun et al. (2002) disagreed with the taxonomic treatment of Safford and supported Dalla Torre & Harms’ decision to raise Dasymaschalon to the generic rank in 1901.

The genus Dasymaschalon is primarily found in southeastern Asia (Craib 1912; Merrill 1915; Sinclair 1955; Ast 1938; Tsiang & Li 1979; Bân 2000; Nurmawati 2003; Wang et al. 2009, 2012) particularly in southern China, Philippines, Indonesia, Malaysia, Thailand, and Indochina. Dalla-Torre & Harms (1901) estimated that Dasymaschalon (Hook & Thomson 1885) may have up to 30 species (Wang et al. 2009, 2012), with three (http://www.philippineplants.org/Families/Annonaceae.html) found in the Philippines and one in India. According to Guo et al. (2018), the genus Dasymaschalon is closely related to Friesodielsia Steenis s.str. (1948:458) and is morphologically distinct with small trees and shrubs (rarely climbers), shallow conical torus, 2–3-cohering petals arranged in one whorl, echinate ornamentation and pollen with thin exine (Walker 1971; Le Thomas 1980, 1981; Van Heusden 1992; Kebler 1993; Doyle & Le Thomas 2012).

While undertaking a field survey of flora on Mount Lantoy KBA of the Municipality of Argao (Image 1), we came across an interesting species of Dasymachalon which did not match other known species. In this paper, we describe a new species of Dasymaschalon from Mount Lantoy Key Biodiversity Area, Cebu Island, Philippines.

MATERIALS AND METHODS

Sampling site

The novel Dasymaschalon was collected during a field survey of flora on Mount Lantoy KBA of the Municipality of Argao (Image 1). Mount Lantoy is one of the new sites classified as a key biodiversity area (KBA) among the 117 terrestrial areas in the Philippines based on irreplaceability and vulnerability criteria (Mallari et al. 2001). These sites are inhabited by 16 restricted-range, four Vulnerable, two Endangered, and two Critically Endangered species (CI/DENR-PAWB/Haribon 2006).

Plant morphological characterization

Photographic records were taken, and voucher specimens were collected and subsequently deposited in the DOST-NICER Biodiversity Museum and University of San Carlos (USC)-Terrestrial Species Museum. The description of morphological characters of the species is based on fruit and vegetative traits (LAWG 1999; Pi et al. 2009; Masungsong et al. 2019; Hernandez et al. 2020) (Ngoc-Daido et al. 2018). The vegetative traits were examined and measured from seedlings and press-dried specimens while field characteristics were noted on the spot. Fruit traits were noted in both fresh specimens and those preserved in 70% ethanol.

The third mature leaves, which are the ones that are fully exposed to sunlight, were chosen as the leaf samples for characterization (Pi et al. 2009). The specimen’s ten mature leaf samples were employed in the investigation. With a hand lens with greater magnification, the leaf samples were inspected. Based on the Leaf Architectural Working Group Manual, the leaf architecture was described (LAWG 1999). Following Masungsong et al. (2019) and Hernandez et al. (2020), petiole length width and leaf blade were measured using a digital caliper, and venation angles, base and apex were determined using a protractor. Additionally, herbarium specimens were analyzed using online photos of the type specimens (www.philippineplants.org.). Except where noted, every photo was taken outdoors where the species were located. The morphological analysis of variance was used for the morphological traits of the D. leilamericanum and the related species (Meeran et al. 2023)

DNA Extraction, amplification, and sequencing

Chloroplast genomic DNA was extracted from dried leaves of the specimens collected from the study site using the QIAGEN DNeasy® Plant Mini Kit while sample cleanup was done using the QIAGEN DNeasy® PowerClean® Pro Cleanup Kit, following manufacturer’s protocols, respectively. For amplification each 50 μl PCR contained 25 μl of MyTaq® HS Red Mix, 2x, 1 μl of each forward and reverse primer, 1 μl of DNA template, and 1 μl nuclease-free water (NFW). The respective thermal cycle conditions were 95⁰C denaturation, 50⁰C annealing, 70⁰C, and 72⁰C extension. A total of 12 samples were sent for sequencing at the facility of Macrogen, Inc., Seoul, South Korea.

For the molecular authentication of the new species, the most commonly preferred gene loci suggested by the Consortium for the Barcoding of Life (CBOL), maturase K (matK) and ribulose 1,5-biphosphate carboxylase (rbcL), were chosen as primers (Yu et al. 2011; Tran et al. 2021). These cpDNA were also used by Guo et al. (2018) in demonstrating the incongruence among different gene trees involving Dasymaschalon and other closely-related taxa. The forward and reverse primers used to amplify matK and rbcL genes were adopted from respective authors cited in de Vere et al. (2015). The primer sequence for the matK-forward (MatK-3FKIM-r) CGTACAGTACTTTTGTGTTTACGAG and matK-R (matK_1R_kim) ACCCAGTCCATCTGGAAATCTTGGTCC. The primer sequence for rbcL-forward (rbcLa-F) ATGTCACCACAAACAGAGACTAAAGC and rbcL-reverse (rbcLajf634R) GAAACGGTCTCTCCAACGCAT.

Alignment and Phylogenetic Analyses

The complementary chromatogram reads from sequenced samples were checked and trimmed for quality control using Finch TV, then aligned to generate a consensus sequence using BioEdit software (CAP contig assembly). The consensus sequence was then reverse complemented followed by alignment with closelyrelated species in MEGA7 via MUSCLE (Edgar 2004). This is then followed by trimming of gaps between the sequences and deletion of sequences with common undefined base calls and sequences with relatively short alignment. There was also an addition of related plant species and/or replacement of different reference sequences in order to lengthen the generated alignment via MUSCLE. Using the same software, the Best Fit Model was determined via the Maximum Likelihood of the default setting (Model Selection ML – Automatic Neighbor-Joining Tree). The phylogenetic tree was then generated using the best model determined for the aligned sequences, and the test of phylogeny was set to bootstrap (1,000 replicates) and completion for gaps regardless of the method.

The sequences were submitted to nucleotide Basic Local Alignment Search Tools (BLAST) of the National Center for Biotechnology Information (NCBI) as well as to the Barcode of Life Database (BOLD) system for similarity checks and identification. Conversely, for further phylogenetic analyses and evolutionary tree construction, the matK and rbcL respective gene sequences of species belonging to all related genera in the family Annonaceae with D. leilamericanum were retrieved and accessed from GenBank® of the National Center for Biotechnology Information (NCBI) (Table 1). The matK and rbcl DNA sequences were submitted to NCBI for the application of accession numbers.

RESULTS AND DISCUSSION

The D. leilamericanum is described through morphological and molecular characterization. The morphological diagnostic characters used are plant habit, leaf pattern, apex of leaf, base, veins order and category, flower, petals, sepals, stamen, pedicels, fruits and monocarp, stalks, and seeds.

Morphological diagnostic characters

The analysis clearly showed that D. leilamericanum differs from other Dasymaschalon in having distinct morphological characteristics such as larger laminar size which belong to notophyll category (LAWG 1999) with leaf area ranging from 2,025–4500 mm², laminar length: width ratio of 4:1, vein orders; Leaf 10 vein category pinnately veined, 20 vein category festooned semicraspedodromous veined, agrophic veins simple, 20 vein spacing irregular, 20 vein angle smoothly decreasing toward the base, inter 20 veins weak inter-secondaries, 30 vein category alternate percurrent, 30 vein coarse sinuous, 30 vein angle to 10 obtuse, 30 vein angle variability inconsistent, 40 and 50 vein category regular polygonal reticulate, and the leaf areolation 5 or more sides. Fruit stalk (infructescence) 29 mm, axillary/terminal, Pedicels (per Monocarp) ranges 13–38 mm, Monocarps 50–60 pcs, ellipsoid 9–20 x 8–13 mm, pinkish to black color, 5–7 seeded/monocarp, embedded in pulpy tissue. Seed dimension 0.7–0.9 cm x 0.5–0.6 cm (Table 2; Images 2, 3, 4, & 5).

Taxonomy

Dasymaschalon leilamericanum Rosales & Lillo, sp. nov.

(Images 2–6)

Type: Holotype: Lillo 00090 (CTU-DOST NICER Biodiversity Museum). Philippines, Cebu Island, Municipality of Argao, Mount Lantoy KBA (Lat. 9.904229, Long. 123.5513) at 99 m elevation (Image 1). The type specimen was located at the base of Mount Lantoy, along the river of Barangay Usmad, bearing multiple fruits, 2 March 2020.

Isotype: USCBM 2675 (University of San Carlos Biological Museum).

Ecology: Near a height of 99 m, the species is found in creeks with thick vegetation at the foot of Mount Lantoy (Image 1). The Carcar formation dominates the Mount Lantoy KBA, which is defined as a forest over limestone habitat type. Its geological makeup is dominated by elevated sedimentary and metamorphic rocks, with limestone making up a sizeable portion of that composition (Audley-Charles et al. 1979).

The species was found 5 m from the river bed. The species associated with Dasymaschalon leilamericanum Rosales and Lillo at the type locality include, among many others, Rapanea philippinensis (A. DC.) Mez (Primulaceae), Ficus benjamina L. (Moraceae), Bischofia javanica Blume (Phyllanthaceae), Guioa koelreuteria (Blanco) Merr. (Sapindaceae), Melicope triphylla (Lam.) Merr. (Rutaceae), Neonauclea calycina (Bartl.) Merr. (Rubiacea), Senna alata (Fabaceae), Schefflera obtusifolia Merr. (Araliaceae), Guioa acuminata Radlk. (Sapindaceae), Goniothalamus elmeri Merr. (Annonaceae), Semecarpus cuneiformis Blanco (Anacardiaceae), Vitex parviflora Juss. (Lamiaceae), Bridelia stipularis Blume (Phyllanthaceae), and Canarium asperum Benth. (Burseraceae).

Distribution: Thus far, Mount Lantoy KBA in the Municipality of Argao, Cebu, is where this new species is known to exist (Image 1). Dasymaschalon species are widespread in forests and thickets at low and medium elevations, sometimes on limestone soil, according to Merrill (1923).

Etymology: This new species is named in honor of Dr. Leila America who actively promoted biodiversity conservation in the Philippines. Dr. America was the former director of the Forestry and Environment Research Division (FERD), prior to her passing, of the Philippine Council for Agriculture, Aquatic and Natural Resources Research and Development (PCAARRD) under the Department of Science and Technology (DOST) of the Philippines.

This new species would add to the list of important species that serve as the basis for the protection and conservation of the mountain as a habitat for the endemic species of Cebu Island. Pelser & Barcelona (2017) recorded the ‘Critically Endangered’ Cynometra cebuensis species in Mount Lantoy KBA. Other endemic species include Copsychus cebuensis Steere, 1890 (Malaki et al. 2018) and Anixa zebuensis Broderip, 1841 (Rosales et al. 2020).

Conservation Status: The new species Dasymaschalon leilamericanum is known only in limestone forest of Mount Lantoy along the river, at an elevation of 99 m. Merrill (1923) designated the three Dasymaschalon species found in the Philippines (www.philippineplants.org) as endemic to the country, just like this new species. The Dasymaschalon clusiflorum (Merr.), described as endemic in the Philippines, was designated as Least Concern (LC) based on the IUCN Redlist (2020–2) (https://www.iucnredlist.org/search?q%20uery=dasymaschalon&searchType=species).

The morphological comparison between Dasymaschalon leilamericanum (a newly described species) and closely related species—Dasymaschalon clusiflorum (Merr.) Merr., Dasymaschalon filipes (Ridl.) Ban., Dasymaschalon ellipticum Nurmawati, and Dasymaschalon blumei Finet & Gagnep—reveals significant differences across various plant characteristics (Meeran et al. 2023) (Table 5). The p-values for the traits Habit, Leaf pattern, 20 vein category, pedicels, monocarps, stalks, and seeds are all p-value is 0.00, indicating highly significant morphological divergence between D. leilamericanum and the other species. These differences suggest D. leilamericanum is a distinct species within the genus Dasymaschalon, with its own set of ecological adaptations and evolutionary characteristics. The morphological traits that set D. leilamericanum apart provide valuable insights into its functional ecology, reproductive success, and evolutionary history, helping to further refine its taxonomic status and improve our understanding of its role within its habitat.

Molecular Analyses

Model Selection for matK and rbcL genes

Models with the lowest BIC scores (Bayesian Information Criterion) were considered to describe the substitution pattern the best. For each model, the AICc value (Akaike Information Criterion, corrected), the maximum likelihood value (lnL), and the number of parameters (including branch lengths) are also presented (Nei & Kumar 2000). Non-uniformity of evolutionary rates among sites may be modeled by using a discrete Gamma distribution (+G) with five rate categories and by assuming that a certain fraction of sites are evolutionarily invariable (+I). Whenever applicable, estimates of gamma shape parameters and/or the estimated fraction of invariant sites were shown. Assumed or estimated values of transition/transversion bias (R) were shown for each model, as well. They were followed by nucleotide frequencies (f) and rates of base substitutions (r) for each nucleotide pair. Relative values of instantaneous r should be considered when evaluating them. For simplicity, the sum of r values is made equal to 1 for each model. For estimating ML values, a tree topology was automatically computed. The analysis involved 39 nucleotide sequences. Codon positions included were 1^st+2^nd+3^rd+Noncoding. All positions containing gaps and missing data were eliminated. There was a total of 693 positions for matK genes and a total of 581 positions for rbcL genes in the final dataset (Tables 3 & 4). Evolutionary analyses were conducted in MEGA7 (Kumar et al 2016).

Phylogenetic relationships

The study represents the first molecular analysis of Dasymaschalon in Cebu Island, Philippines. As shown in reconstructed phylogenetic tree of the matK and rbcL gene sequences (Figures 1 & 2), D. leilamericanum sp. nov. is a new species molecularly related to Uvaria species as with other Dasymaschalon species. The position of D. leilamericanum sp. nov. in the phylogenetic tree is not unusual. Wang et al. (2012) and Guo et al. (2018) described this non-monophyletic characteristic of Dasymaschalon, particularly with regards to cpDNA genes. As also suggested by Guo et al. (2018), the incongruence of Dasymaschalon might be a result of hybridization with closely-related genera.

The evolutionary history using the matK and rbcL genes were inferred by using the Maximum Likelihood method based on the Tamura 3-parameter model (Tamura 1992) (Figures 1 & 2). The tree with the highest log likelihood (-1796.97) for matK gene and (-1208.91) for rbcL gene were shown (Table 3 & 4). The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach and then selecting the topology with superior log likelihood value. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. Evolutionary analyses were conducted in MEGA7 (Kumar et al 2016).

The phylogenetic analyses of Couvreur et al. (2011) are in agreement with the inferred association of Dasymaschalon with another clade, containing species from the genera Uvaria and Cyathostemma, and the clade made up of species from the genera Monanthotaxis, Melodorum, and Desmos. The majority of Dasymaschalon species (D. macrocalyx, D. clusiflorum, and D. ellipticum) belong to a single, monophyletic group that is strongly supported. The D. leilamericanum demonstrated non-monophyly as it is more closely related to genus Uvaria than to the major clade of Dasymaschalon or with the clade of Desmos and Monanthotaxis.

According to Wang et al. (2012), certain Annonaceae species showed some degree of evolutionary flexibility in their morphological differences. A unique example of evolutionary adaptability may be seen in the pollination chamber of the flower in Dasymaschalon. Wang et al. (2012) also noted that some Dasymaschalon species (D. tibetense, D. filipes, and D. longiforum) belong to a distinct clade that is closely connected to Asian Friesodielsia species. This clade is distinct from the clade that contains the majority of Dasymaschalon species. The non-monophyly of the three species indicates a parallel evolution with another lineage where morphological convergence occurs (Zander 2008). The fundamental idea that all species are monophyletic restricts the ability of other species to evolve and their history to be complicated, which could lead to an underestimation of variability within and among closely related taxa (Alström et al. 2011).

CONCLUSION AND RECOMMENDATION

A new species of Dasymaschalon (Annonaceae), Dasymaschalon leilamericanum, is described and illustrated with diagnostic characters. Several notable morphological characters are the larger laminar size which belong to notophyll category with an area ranges from 2,025–4,500 mm², laminar length : width ratio of 4:1, 2⁰ vein festooned semicraspedodromous, agrophic vein simple, 2⁰ vein spacing irregular, 2⁰ vein angle smoothly decreasing toward the base, inter 2⁰ veins weak intersecondaries, 3⁰ vein category alternate percurrent, 3⁰ vein coarse sinuous, 3⁰ vein angle to 1⁰ obtuse, 3⁰ vein angle variability inconsistent, 4⁰ and 5⁰ vein category regular polygonal reticulate, and leaf areolation five or more sides, Monocarps 50–60, ellipsoid 9–20 x 8–13 mm, pinkish to black color, longer fruit pedicel, and 5–7 ellipsoid seeds/monocarp. The significant differences observed in the plant morphology of D. leilamericanum compared to D. clusiflorum, D. filipes, D. ellipticum, and D. blumei—as indicated by the p-values of 0.000 across key morphological traits (Habit, leaf pattern, 2⁰ vein category, pedicels, monocarps, stalks, and seeds) suggest that D. leilamericanum is a distinct species within the Dasymaschalon genus. These differences highlight the species’ unique adaptations to specific ecological conditions, reproductive strategies, and evolutionary pathways. Phylogenetic trees of matK and rbcL genes showed that D. leilamericanum did not match to any species under Dasymaschalon but it is closer to genus Uvaria. Although the D. leilamericanum shares some morphological characteristics with other Dasymaschalon species, genetically it is closer to another genus thus the non-monophyletic characteristic exhibited in the phylogenetic tree is unexpected. The DNA barcode established in this study can help enrich the literature on molecular data of Philippine flora. The Mt. Lantoy KBA in Argao, Cebu, Philippines, is becoming a hotspot for biodiversity conservation with the addition of new species. It is recommended that future studies on phylogenetic analyses be conducted on other Dasymaschalon species found in the Philippines to understand its intergeneric relationships, endemicity, and evolutionary history.

Table 1. List of selected species used to reconstruct the phylogenetic tree for Dasymaschalon leilamericanum sp. nov. and their GenBank Accession information.

	Species	GenBank Accession
		rbcL	matK
1	Dasymaschalon leilamericanum sp. nov.	[PQ878320]	[PQ869009]
2	Dasymaschalon macrocalyx	[AY841610.1]	[AB924891.1]
3	Dasymaschalon clusiflorum	[JQ768668.1]	[JQ768548.1]
4	Dasymaschalon filipes	[JQ768672.1]	[MH308078.1]
5	Dasymaschalon ellipticum	[JQ768670.1]	[JQ768550.1]
6	Dasymaschalon oblongatum	[JQ768679.1]	[JQ768559.1]
7	Dasymaschalon megalanthum	[JQ768678.1]	[JQ768558.1]
8	Dasymaschalon longiflorum	[JQ768675.1]	[MH308073.1]
9	Dasymaschalon dasymaschalum	[MT264015.1]	[MT264031.1]
10	Dasymaschalon glaucum	[JQ768673.1]	[JQ768553.1]
11	Dasymaschalon acuminatum	[MT264012.1]	[MT264028.1]
12	Desmos dumosus	[JQ768689.1]	[HG005013.1]
13	Desmos chinensis	[JQ762414.1]	[KP093298.1]
14	Desmos polycarpus	[KF496673.1]	[KX786589.1]
15	Desmos elegans	[HQ214067.1]	[JQ768571.1]
16	Desmos cochinchinensis	[JQ768688.1]	[OL604143.1]
17	Friesodielsia desmoides	[AY841618.1]	[JQ768577.1]
18	Friesodielsia biglandulosa	[MG896081.1]	[MG910438.1]
19	Friesodielsia glauca	[MG896051.1]	[MG910428.1]
20	Schefferomitra subaequalis	[KX786628.1]	[KX786606.1]
21	Uvaria macrophylla	[KP094324.1]	[KP093408.1]
22	Uvaria concava	[JN175197.1]	[JN175167.1]
23	Uvaria cordata	[JN175198.1]	[AB924906.1]
24	Uvaria wrayi	[FJ743821.1]	[AB924778.1]
25	Uvaria siamensis	[FJ743824.1]	[AB925067.1]
26	Uvaria lucida	[MN166687.1]	[MN166628.1]
27	Melodorum fruticosum	[AY319071.1]	[AB924724.1]
28	Monanthotaxis micrantha	[KX761331.1]	[KX761300.1]
29	Monanthotaxis buchananii	[JQ768700.1]	[JX517585.1]
30	Monanthotaxis fornicata	[JQ768702.1]	[JQ768583.1]
31	Monanthotaxis montana	[MF353789.1]	[MF353672.1]
32	Monanthotaxis whytei	[AY841635.1]	[EF179278.1]
33	Cyathostema viridiflorum	[AY841607.1]	[FJ743746.1]
34	Cleistochlamys kirkii	[JX572412.1]	[JX517486.1]
35	Dielsiothamnus divaricatus	[EU169759.1]	[KX146236.1]
36	Meiocarpidium lepidotum	[EU169754.1]	[EU169687.1]
37	Mitrella kentii	[AY841633.1]	[FJ743751.1]
38	Monocyclanthus vignei	[EU169765.1]	[EU169698.1]
39	Ophrypetalum odoratum	[EU169767.1]	[EU169702.1]
40	Pyramidanthe prismatica	[JN175193.1]	[JN175163.1]
41	Toussaintia orientalis	[EU169756.1]	[EU169689.1]

Table 2. Morphological comparison of Dasymaschalon leilamericanum sp. nov., Dasymaschalon clusiflorum (Merr.) Merr, Dasymaschalon filipes (Ridl.) Ban.Dasymaschalon ellipticum Nurmawati, and Dasymaschalon blumei (Finet & Gagnep 1906; Nurmawati 2003).

Plant Morphology (LAWG 1999)	Dasymaschalon leilamericanum sp. nov.	Dasymaschalon clusiflorum (Merr.) Merr.	Dasymaschalon filipes (Ridl.) Ban	Dasymaschalon ellipticum Nurmawati	Dasymaschalon blumei Finet & Gagnep
Habit	Small tree 5 m in height.	Small tree up to 10 m high.	Small trees, 5 m high. Branches glabrous	Small trees up to 5 m. Branches glabrous	Branches are either tomentose or glabrous and either a shrub or a small tree with a height of 6 m.
Leaf pattern	Simple and alternate in arrangement, petiolar attachment marginal and swollen appearance, glabrous, lamina chartaceous to sub coriaceous, laminar size notophyll with leaf area ranges from 2,025–4500 mm^2, laminar shape lanceolate, symmetrical, leaf margin entire and wavy	Petiole range is 1–2 x 7–15 mm, it is glabrous; ellipsoidal, lamina can be chartaceous and some are sub coriaceous, ellipsoidal in shape and narrow, some can be lanceolate or can be ellipsoidal while others can be broad, laminar size notophyll with leaf area ranges from 5.5–23.7 x 1.3–9 cm, pale on the lower surface; and glabrous in all sides including the midrib.	Petiole ranges from 9–17 x 2–3 mm; lamina is characterized with sub coriaceous or can be chartaceous, it is oblanceolate in shape or can be ellipsoidal, leaf area ranges from 16.5–35 x 5–9 cm. glaucous in the lower surface,	Petiole ranges from 10–17 x 3 mm, described as glabrous; sub-coriaceous for the lamina, oblong in shape, leaf area ranges from 17.5–33.6 x 4–9.6 cm, glaucous in the lower surface and glabrous in all sides in the midrib.	Petiole ranges from 2–3 x 3–5 mm, thickly tomentose or can be glabrous, covered mostly by a leaf base; lamina can be sub coriaceous or some can be chartaceous, leaf area ranges from 9–31 x 4–10 cm, oblanceolate
Apex of Leaf	Apex angle is acute; shape can be acuminate	Apex acute and can be shortly acuminate	Apex acute to acuminate	Apex acute or acuminate	Apex acute, shortly to abruptly acuminate
Base	Base angle obtuse, and base shape rounded	Base cuneate to subrounded	Base rounded	Base cuneate to sub rounded	Base cordate
Veins order
1^0vein category	Pinnately veined	Pinnately veined	Pinnately veined		Pinnately veined
2^0 vein category	2^0 vein category festooned semicraspedodromous, 12–14 pairs, agrophic veins simple, 2^0vein spacing irregular, 2^0 vein angle smoothly decreasing toward the base, inter 2^0 veins weak inter-secondaries	Secondary veins slender raised above, curved, 6–12 pairs, including with the midrib an angle of about 35–55 degree, glabrous; lateral veins anastomosing inconspicuous	Secondary veins slender raised above, curved, including with the midrib an angle of about 55–60 degree, 14–17 pairs; lateral veins anastomosing inconspicuous.	Secondary veins slender raised above, glabrous, curved, 13–19 pairs, including with the midrib an angle of about 50–60 degree; lateral veins anastomosing.	Secondary veins faint, curved, 10–14 pairs, midrib an angle of about 35–55^0, glabrous or densely tomentose; lateral veins anastomosing inconspicuous
3^0 vein category	3^0 vein category alternate percurrent, 3^0 vein coarse sinuous, 3^0 vein angle to 1^0 obtuse, 3^0 vein angle variability inconsistent,	Tertiary veins reticulate.	Tertiary veins are scalariform.	Tertiary veins scalariform	Tertiary veins are scalariform.
4^0and 5^0 vein category	4^0and 5^0 vein category regular polygonal reticulate, and the leaf areolation 5 or more sides.
Flower	Unknown	Axillary or terminal, single, seldom raceme two –six flowers.	Flowers unknown	Solitary, some can be raceme with three–five flowers	Axillary or terminal, solitary, seldom raceme with two–four flowers.
Petals	Unknown	Three coriaceous, ovate, triangular, lanceolate or rhomboid petals, with or without a distinct claw, 1.2–11 x 1–2.4 cm, thick 0.5–3 mm, a sharp or directly acuminate apex, valvate reduplicate, and puberulent.	Petals unknown	Petals 3, coriaceous, linear lanceolate, 3.3–7 cm x 0.8–1.2 mm, thick c. 1mm, apex described as sharp, with valvate reduplicate, not clearly defined claw, and velutinous.	Three–four petals, some are coriaceous others can be sub-coriaceous, it is lanceolate, size range is 3.5–7 x 1.5–2.4 cm, thickness is 0.5–1 mm, apex described as valvate reduplicate, and acuminate
Sepals	Unknown	Sepal is predominantly ovate, size ranges from 2–4 x 2–5 mm, apex can either be acuminate or acute, rarely pubescent.	Sepal is predominantly ovate, c. 3 x 4 mm, apex acuminate, sparsely pubescent	Sepal is predominantly ovate c. size range is 3–4 x c. 2 mm, apex can be rarely pubescent, and mucronate.	Triangular sepal with size ranges from c. 4 x 4–5 mm, apex van be densely pubescent, sparsely tomentose or acuminate
Stamen	Unknown	Stamens 2–4 mm x c. 0.5–1mm, apex discoid, glandular dots absent.	Stamens unknown	Stamens size ranges from 23 x c. 1 mm, described as convex apex with the presence of dotted glandular	Stamens 4 x 1 mm, apex convex, glandular dots absent
Pedicels	3–4 cm long	Pedicel 1.2–4.2 cm x 1–2 mm, glabrous.	Pedicel 19–33 cm x c. 1mm, glabrous (bearing carpidia).	Pedicel ranges from c. 1 mm x 1.5–2 cm and described as glabrous.	Pedicel rangers from 3.4–15 cm x 1.5–2 mm, predominantly tomentose or densely pubescent, and glabrous
Fruits	Axillary or terminal	Axillary or terminal	Axillary or terminal	Axillary or terminal	Axillary or terminal
Monocarps	30–50, ellipsoid 9–20 x 8–13 mm, pinkish to black color	Ranges from 20–50 and described as globose, with size ranges from 7–17 x 5–8 mm	Ranges from 20–35, ellipsoid, with size ranges from 10–14 x 7–9 mm.	Ranges from 20–30, described as ellipsoidal to sub globose, size ranges from 7.5–10 x 6–7.5 mm	Monocarps 7–30
Stalks	Stalks 13 x 38 mm glabrous	Size ranges 8–21 x 1–2 mm, described as rarely pubescent to glabrous	Size ranges from 8–22 x c. 0.5 mm, described as rarely pubescent.		Rarely pubescent, seldom glabrous, size ranges from 4–15 x 1–2 mm
Seeds	5–7 seeds, ellipsoid, embedded in pulpy tissue. Seed dimension 0.7–0.9 cm x 0.5–0.6 cm.	Granulate with 1 (-2) seeds, rarely pubescent to glabrous	Granulate with 1(–2) seeds, villous apiculum, and rarely pubescent.	1(–2) seeds, slightly smooth, glabrous.	Granulate with 2–7 seeds, described as ellipsoidal but seldom globose on each of its segment, size ranges from 7–9 x 5–8 mm.

Table 3. Maximum likelihood fits of 24 different nucleotide substitution models for the matK genes sequences aligned for Dasymaschalon leilamericanum sp. nov.

Model	#Parameter	BIC	AICc	InL	Invariant
T92	77	4397.269592	3755.961766	-1800.758018	n/a
T92+G	78	4388.799433	3749.29861	-1796.420642	n/a
T92+I	78	4389.896853	3750.39603	-1796.969352	0.456754048
T92+G+I	79	4399.004029	3751.310358	-1796.420645	9.76544E-06
HKY	79	4406.668791	3758.97512	-1800.253025	n/a
HKY+G	80	4407.962061	3752.075691	-1795.797364	n/a
HKY+I	80	4409.135406	3753.249036	-1796.384037	0.454509194

Table 4. Maximum Likelihood fits of 24 different nucleotide substitution models for the rbcL genes sequences aligned for Dasymaschalon leilamericanum sp. nov.

Model	#Parameter	BIC	AICc	InL	Invariant
K2	64	3048.949444	2546.264332	-1208.914456	n/a
T92	65	3050.818567	2540.285826	-1204.918388	n/a
K2+G	65	3052.503191	2541.97045	-1205.7607	n/a
K2+I	65	3053.728609	2543.195868	-1206.373409	0.45697074
T92+G	66	3054.534347	2536.154189	-1201.845649	n/a
T92+I	66	3055.717657	2537.3375	-1202.437304	0.45697074
K2+G+I	66	3062.2175	2543.837343	-1205.687226	9.24534E-06

Table 5. Multivariate analysis of morphological data Dasymaschalon leilamericanum sp. nov..

Plant morphology (LAWG 1999)	SS	df	MS	F	P-value	FCrit
Habit	94.49	4	23.62	45.2	0.00	2.87
Leaf pattern	17935657	4	4483914	4.52	0.00	2.87
2^0 vein category	189.2	4	47.3	13.75	0.00	2.87
Pedicels	2457.68	4	614.42	19.07	0.00	2.87
Monocarps	2290.24	4	572.56	6.23	0.00	2.87
Stalks	4109.44	4	1027.36	5.58	0.00	2.87
Seeds	96.56	4	24.14	23.21	0.00	2.87

FOR FIGURES & IMAGES - - CLICK HERE FOR FULL PDF

REFERENCES

Alström, P., S. Höhna, M. Gelang, P.G.P. Ericson & U. Olsson (2011). Non-monophyly and intricate morphological evolution within the avian family Cettiidae revealed by multilocus analysis of a taxonomically densely sampled dataset.BMC Evolutionar Biology 11:352. https://doi.org/10.1186/1471-2148-11-352

Ast, S. (1938). Anonacées, pp. 59–123. In: Humbert, H. (wd.) Flore Générale de l’Indo-Chine. Suppl. 1. Masson, Paris. https://doi.org/10.5962/bhl.title.44886

Audley-Charles, M.G., D.J. Carter, A.J. Barber, M.S. Norvick & S. Tjokrosapoetro (1979). Reinterpretation of the geology of Seram: implications for the Banda Arc and Northern Australia. Journal of the Geological Society 136: 547–568.

Bân, N.T. (2000). Flora of Vietnam, Vol. 1. Science & Technics Published House, Hanoi, pp. 173–187.

Bân, N.T. (1975). Notes in the genera Dasymaschalon (Hook.f et Thoms) Dalla Torre et Harms (Annonaceae). Botanicheskii Zhurnal 60.2: 224–233.

Cadiz, G.O. & I.E. Buot Jr (2009). An enumeration of the woody plants of Cantipla forest fragments, Cebu Island, Philippines. The Thailand Natural History Museum Journal 4(2): 71–72.

CI/DENR/PAWB-Haribon (2006). Priority Sites for Conservation in the Philippines: Key Biodiversity Areas. Quezon City, Philippines: Conservation International Philippines. 24 pp. Conservation International (CI), Department of Environment and Natural Resources – Protected Areas and Wildlife Bureau (DENR-PAWB), Haribon Foundation for the Conservation of Nature (HARIBON). Retrieved from http://www.conservation.org/global/philippines/publications/Pages/Priority-Sitesfor-Conservation-Key-Biodiversity-Areas.aspx.

Couvreur, T.L.P., M.D. Pirie, L.W. Chatrou, R.M.K. Saunders, Y.C.F. Su, J.E. Richardson & R.H.J. Erkens (2011). Early evolutionary history of the flowering plant family Annonaceae: steady diversification and boreotropical geodispersal. Journal of Biogeography 38: 664–680.

Craib, W.G. (1912). Contributions to the flora of Siam. Bulletin of Miscellaneous Information 3: 144–155. https://doi.org/10.5962/bhl.title.21865

de Vere, N. D., T.C. Rich, S.A. Trinder & C. Long (2015). DNA barcoding for plants. In Plant Genotyping pp. 101–118. Humana Press, New York, 118 pp.

Dalla-Torre, C.W. & H. Harms (1901). Genera siphonogamarum ad systema Englerianum conscripta, Part 3. Engelmann, Leipzig, pp. 172–175. https://doi.org/10.5962/bhl.title.26684

Doyle, J. & A. Le Thomas (2012). Evolution and phylogenetic significance of pollen in Annonaceae. Botanical Journal of the Linnean Society 169: 190–221. https://doi.org/10.1111/j.1095-8339.2012.01241.x

Edgar, R.C. (2004). MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32(5): 1792–1797.

Finet, A. & F. Gagnepain (1906). Contributions à l’étude de la flore de l’Asie orientale. Bulletin de la Société Botanique de France 53 (Mémoires 4): 55–170 + pl. 9–20.

Fries, R.E. (1959). Annonaceae. In: Melchior, H. (Ed.). Die Natürlichen Pflanzenfamilien. Duncker & Humblot, Berlin, pp. 1–170.

Guo, X., D.C. Thomas & R.M.K. Saunders (2018). Gene tree discordance and coalescent methods support ancient intergeneric hybridisation between Dasymaschalon and Friesodielsia (Annonaceae). Molecular Phylogenetics and Evolution 127: 14–29.

Hernandez, J.O., L.S.J. Maldia, D.E. Pulan, I.E. Buot Jr. & B.B. Park (2020). Leaf architecture and petiole anatomy of Philippine Dipterocarpus species (Dipterocarpaceae). Bangladesh Journal of Plant Taxonomy 27(1): 1‒14.

Hooker, J.D. & T. Thomson (1855). Flora Indica: being a systematic account of the plants of British India 1. Pamplin, London, 285 pp. https://doi.org/10.5962/bhl.title.57706

Hutchinson, J. (1923). Contributions towards a phylogenetic system of flowering plants, 2. The genera of Annonaceae. Bulletin of Miscellaneous Information 1923: 241–261. https://doi.org/10.2307/4120580

Kebler, P.J.A. (1993). Annonaceae, pp. 93–129. In: Kubitzki, K., G. Rohwer & V. Bittrich (ed.). The Families and Genera of Vascular Plants: Flowering Plants, Dicotyledons. Magnoliid, Hamanelid and Caryophyllid Families 2. Springer-Verlag, Berlin, 653 pp.

Klucking, E.P. (1986). Leaf venation patterns 1: Annonaceae. J. Cramer, Berlin & Stuttgart.

Koek-Noorman, J., A.K.V. Setten & C.M.V. Zuilen (1997). Studies in Annonaceae XXVI. Flower and fruit morphology in Annonaceae. Their contribution to patterns in cluster analysis. Botanisches Jahrbücher für Systematik, Pflanzengeschichte und Pflanzengeographi 119: 213–230.

Kimura, M. (1980). A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16:111–120.

Kumar, S., G. Stecher & K. Tamura (2016). MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33:1870–1874.

LAWG (1999). Manual of Leaf architecture — Morphological Description and Categorization of Dicotyledonous and Net-Veined Monocotyledonous Angiosperms. Leaf Architecture Working Group, Smithsonian Institution, 65 pp.

Le Thomas, A. (1980). Ultrastructural characters of the pollen grains of African Annonaceae and their significance for the phylogeny of primitive angiosperms: first part. Pollen & Spores 22: 267–342.

Li, P.T. (1993). Novelties in Annonaceae from Asia. Guihaia 13: 311–315.

Lillo, E.P., A.B. Malaki, S.M.T. Alcazar, R.U. Nuevo & R. Rosales (2019). Native Trees on Mount Lantoy Key BiodiversityAreas (KBA), Argao, Cebu, Philippines. Philippine Journal of Science 148(2): 359–371.

Lillo, E.P., A.B. Malaki, S.M.T. Alcazar, B. Redoblado, J.L. Diaz, J.P. Pinote, R. Rosales & I.E. Buot Jr (2020). Native tress in Nug-as forest Key Biodiversity Area, Cebu, Philippines. Biodiversitas 21(9): 4162–4167.

Lillo, E.P., A.B. Malaki, S.M.T. Alcazar, R. Rosales, B.R. Redoblado, J.L.B. Diaz, E.M. Pantinople & I.E. Buot Jr (2021). Inventory of native and mother trees in Key Biodiversity Areas of Cebu Island, Philippines for species selection in local reforestation programs. Biodiversitas 22(11): 4740–4749. https://doi.org/10.13057/biodiv/d221105

Loureiro, J. (1790). Flora Cochinchinensis, Vol. 1. Ulyssipone, Lisbon, 353 pp. https://doi.org/10.5962/bhl.title.40199

Mallari, N.A.D., B.R. Tabaranza Jr. & M.J. Crosby (2001). Key Conservation Sites in the Philippines: A Haribon Foundation and Bird Life International Directory of Important Bird Areas. Lepiten-Tabao M, Gee GA eds. Makati City, Philippines: Bookmark, Inc. 484p.

Malaki, A.B., R.V., Cruz, Bantayan, D.A. Racelis, I.E. Buot, Jr. & L.M. Florece (2018). Factors Affecting the spatial distribution of Black Shama Copsychus cebuensis Steere, 1890 in Argao Watershed Reserve. Philippine Journal of Science 147: 175–189.

Masungsong, L.A., M. Belarmino & I.E. Buot Jr. (2019). Delineation of the selected Cucumis L. species and accessions using leaf architecture characters. Biodiversitas 20: 629–635.

Maxwell, J.F. (1989). Botanical notes on the vascular flora of Chiang Mai Province, Thailand. Natural History Bulletin of the Siam Society 37: 177–185.

Meeran, M., A., Sami, M. Haider, & M. Umar (2023). Multivariate analysis for morphological traits of Amaranthus viridis. Bulletin of Biological and Allied Sciences Research 8: 46. https://doi.org/10.54112/bbasr.v2023i1.46

Merrill, E.D. (1915). Studies on Philippine Annonaceae, I. Philippine Journal of Science, Section C. Botany 10: 227–264.

Merrill, E.D. (1923). An Enumeration of Philippine Flowering Plants, Vol. 2. Manila, Philippines: Bureau of Printing, 530 pp.

Morán-Ordoñez, A. (2020). Conservation of “new” species within and beyond protected areas. Animal Conservation 23: 353–354.

Nei, M. & S. Kumar (2000). Molecular Evolution and Phylogenetics. Oxford University Press, New York. Provide page numbers.

Ngoc-Dai, D.O., L.Ý. Nngoc-Sam, L.Ê. Thi-Huong, B.Á. Troung & Vuongh (2018). Dasymaschalon bachmaensis (Annonaceae), a new species from Bạch Mã National Park, North Central Coast region, Vietnam. Phytotaxa 379(1): 049–056. https://doi.org/10.11646/phytotaxa.379.1.4

Nurmawati, S. (2003). Malesian species of Dasymaschalon (Annonaceae). Floribunda 2(3): 67–81.

Pelser, P.B. & J.F. Barcelona (2017). Base of leaflets. Retrieved from www.phytoimages.siu.edu. Accessed 2 June 2019).

Pi, E.X., Q.F. Peng, H.F. Lu, J.B. Shen. & Y.Q. Du (2009). Leaf morphology and anatomy of Camellia section Camellia (Theaceae). Botanical Journal of the Linnean Society 159: 456–476.

Quimio, J. (2006). Abundance status of flora in Managa-Kotkot-Lusaran watersheds, Cebu, Philippines. Annals of Tropical Research 28(2): 53–75.

Rosales, R.C., E. Lillo, S.M. Alcazar, L. Colita, J. Caballero & A.B. Malaki (2020). Species composition, relative abundance, and distribution of land snail species in Mt. Lantoy Key Biodiversity Area, Cebu, Philippines. Biodiversitas 21: 5438–5447.

Safford, W.E. (1912). Desmos the proper generic name for the so-called Unonas of the Old World. Torrey Botanical Society 39: 501–508. https://doi.org/10.2307/2479122

Simkins, A.T., G.M. Buchanan, R.G. Davies & P.F. Donald (2020). The implications for conservation of a major taxonomic revision of the world’s birds. Animal Conservation 23: 345–352.

Sinclair, J. (1955). A revision of the Malayan Annonaceae. Gardens’ Bulletin Singapore 14: 149–516.

Sun, T.X., H. Wu, P.T. Li, J. Sun & X.F. Zheng (2002). Leaf anatomy of Desmos and Dasymaschalon (Annonaceae) from China in relation to taxonomic significance. Acta Phytotaxonomica Sinica 40: 385–395.

Tran, T.K.P., T.T.T. Vu & S. Widiarsih (2021). Comparison of matK and rbcL DNA barcodes for genetic classification of jewel orchid accessions in Vietnam. Journal of Genetic Engineering and Biotechnology 19: 1–8.

Tsiang, Y. & P.T.Li (1979). Annonaceae, pp. 10–175. In: Tsiang, Y. & P.T. Li (eds.). Flora Reipublicae Popularis Sinicae. Vol. 30 (2). Science Press, Beijing.

Van Heusden, E.C.H. (1992). Flowers of Annonaceae: morphology, classification, and evolution. Blumea Supplement 7: 1–218.

Walker, J.W. (1971). Pollen morphology, phytogeography, and phylogeny of the Annonaceae. Contributions from the Gray Herbarium of Harvard University 202: 1–131.

Wang, J., P. Chalermglin & R.M.K. Saunders (2009). The genus Dasymaschalon (Annonaceae) in Thailand. Systematic Botany 34: 252–265.

Wang, J., D.C. Thomas, Y.C.F. Su, S. Meinke, L.W. Chatrou & R.M.K. Saunders (2012). A plastid DNA phylogeny of Dasymaschalon (Annonaceae) and allied genera: evidence for generic non-monophyly and the parallel evolutionary loss of inner petals. Taxon 61(3): 545–558. https://doi.org/10.1002/tax.613005

Yu, J., J.H. Xue & S.L. Zhou (2011). New universal matK primers for DNA barcoding angiosperms. Journal of Systematics and Evolution 49: 176–181.

Zander, R.H. (2008). Evolutionary inferences from non-monophyly on molecular trees. Taxon 57(4): 1182–1188. https://doi.org/10.1002/tax.574011