Journal of Threatened Taxa | www.threatenedtaxa.org | 26 May 2022 | 14(5): 21102–21116

ISSN 0974-7907 (Online) | ISSN 0974-7893 (Print)

https://doi.org/10.11609/jott.7837.14.5.21102–21116

#7837 | Received 19 January 2022 | Final received 28 April 2022 | Finally accepted 05 May 2022

Environmental DNA as a tool for biodiversity monitoring in aquatic ecosystems – a review

Manisha Ray¹ & Govindhaswamy Umapathy²

^1.2CSIR - Centre For Cellular And Molecular Biology, Uppal Rd, Hyderabad, Telangana 500007, India.

¹manisharay@ccmb.res.in, ²guma@ccmb.res.in (corresponding author)

Editor: Anonymity requested. Date of publication: 26 May 2022 (online & print)

Citation: Ray, M. & G. Umapathy (2022). Environmental DNA as a tool for biodiversity monitoring in aquatic ecosystems – a review. Journal of Threatened Taxa 14(5): 21102–21116. https://doi.org/10.11609/jott.7837.14.5.21102-21116

Copyright: © Ray & Umapathy 2022. Creative Commons Attribution 4.0 International License. JoTT allows unrestricted use, reproduction, and distribution of this article in any medium by providing adequate credit to the author(s) and the source of publication.

Funding: Department of Biotechnology (DBT) grant no. BT/PR29032/FCB/125/4/2018 and Council of Scientific & Industrial Research (CSIR), Govt. of India.

Competing interests: The authors declare no competing interests.

Author details: Manisha Ray has post-graduation in Molecular Microbiology and is currently a PhD student at CSIR-CCMB, Hyderabad. Her research interest lies in studying microbial ecology and the novel functions of microbes that help ecosystems to thrive and support other life forms. Her doctoral work aims at using eDNA as a tool to decipher the species and genomic diversity of Phylum Cyanobacteria in relation to ecosystem services and changing physico-chemical factors of Chilika Lake, Odisha. Govindhaswamy Umapathy is a Conservation Biologist. He works on understanding species extinction in human dominated landscapes and develops various biotechnological tools in biodiversity conversation at Laboratory for the Conservation of Endangered Species, CSIR-CCMB, Hyderabad.

Author contributions: MR and GU conceptualized the content of the paper. MR collected all relevant references and wrote the manuscript. Both MR and GU revalidated the content and proofread the manuscript.

Acknowledgements: We are thankful to S. Manu and Gopi Krishnan for their constant suggestions to improve the manuscript.

Abstract: The monitoring of changes in aquatic ecosystems due to anthropogenic activities is of utmost importance to ensure the health of aquatic biodiversity. Eutrophication in water bodies due to anthropogenic disturbances serves as one of the major sources of nutrient efflux and consequently changes the biological productivity and community structure of these ecosystems. Habitat destruction and overexploitation of natural resources are other sources that impact the equilibrium of aquatic systems. Environmental DNA (eDNA) is a tool that can help to assess and monitor aquatic biodiversity. There has been a considerable outpour of research in this area in the recent past, particularly concerning conservation and biodiversity management. This review focuses on the application of eDNA for the detection and relative quantification of threatened, endangered, invasive and elusive species. We give a special emphasis on how this technique developed in the past few years to become a tool for understanding the impact of spatial-temporal changes on ecosystems. Incorporating eDNA based biomonitoring with advances in sequencing technologies and computational abilities had an immense role in the development of different avenues of application of this tool.

Keywords: eDNA, non-invasive, biomonitoring, endangered, eutrophication, anthropogenic

Introduction

Earth is an abode of numerous living organisms which exist in varying environmental conditions and all are ultimately interconnected. Major unknowns in estimating global biodiversity are: how many species inhabit Earth, and what is their rate of extinction. Only a fraction of total biodiversity is known, and a substantial number of species that have not yet been accounted for and are vanishing without our knowledge. Since all species are dependent on each other in some way or another, the removal of one drastically affects other species. Unravelling each point in this network of life is important to study how an ecosystem at large functions and also to understand the life history of a species and how new communities get established.

Aquatic ecosystems comprising freshwater, brackish, and marine water in nature are the sources of a lot of species diversity ranging from microbes to mammals. The impact of human activities on these life forms is multifactorial. An increase in the emission of carbon from anthropogenic actions is leading to an increase in water temperature, acidification and oxygen deprivation of aquatic systems (Jiao et al. 2015). The changes in the abiotic parameters of the ecosystem is accompanied with impacting the cycling and efflux of nutrients. These changes in turn regulates the geographic distribution of the life forms in that habitat (Nazari-Sharabian et al. 2018). According to the special report of IPCC (The Intergovernmental Panel on Climate Change) on changing ocean and cryosphere 2019, by the year 2100, the ocean will witness an increase in temperature by 2 to 4 times and oxygen levels will decline further resulting in increase in the volume of oxygen-deficient zones (OMZ). These changes will impact ecosystem services with a projected decrease in fish catch potential and global marine biomass, which will further impact revenue generation, food security and threaten livelihood. Analysing the world’s biodiversity becomes a critical aspect of learning about the distribution of these “biodiversity hotspots” and applying conservation practices to protect these areas.

The traditional practices of estimating biodiversity are biased towards the sampling of particular species (Gunzburger 2007) or can also pose a risk to sensitive organisms. In recent times, molecular techniques are gaining importance in the estimation of biodiversity and its conservation in the world. One such molecular tool is the study of environmental DNA (eDNA), which has tremendous potential to develop our understanding of biodiversity science and provide implications for conservation practices with census data of species present at a comprehensive scale in real-time.

What is environmental DNA?

The term ‘environmental DNA’ (eDNA) was introduced in the field of microbiology for the detection of microbial communities in sediments by Ogram et al. (1987). eDNA has been classified based on particulate size: aggregates of eDNA greater than 0.2 µm were termed as particulate DNA (P-DNA) while eDNA less than 0.2 µm is termed as dissolved DNA (D-DNA) by (Paul et al. 1987). DNA extracted non-invasively from environmental sources like soil, air, or water is termed environmental DNA (eDNA). It has a polydisperse nature, i.e., the origin of eDNA can have several sources like sloughed cells, faecal matter, spores, slimy coating (in amphibians), or dead carcasses. Based on the source of origin of eDNA, it undergoes selective decay and thus complicates the evaluation of decay rates (Wilcox et al. 2015). eDNA has been used in the aquatic system to either detect the presence or absence of a species or for quantitative estimation of a particular species. Its application varies between lotic and lentic ecosystems as their nature varies. The lotic ecosystem is flowing and can transport eDNA directionally downstream from the correct location of the target organism, whereas the lentic ecosystem is stagnant. eDNA is released into the environment and subsequently undergoes progressive decay due to many biotic and abiotic factors.

Factors governing the concentration of EDNA in the aquatic environment:

Based on the literature review, it has been perceived that there can be numerous factors that can govern the concentration of eDNA at a particular time and space, but can be primarily divided into three categories:

eDNA released by the organism

Persistence of eDNA in different environmental conditions

Capture protocols for eDNA and sensitivity of detection assay

eDNA release by the organism

The concentration of eDNA released by an organism and the degradation rate of DNA in a particular environment are the two attributes on which the concentration of eDNA varies on a given spatial-temporal scale. The release of eDNA is a complex interaction between environmental conditions, the natural history of an organism, its metabolic rate, and the developmental stage. With an increase in the temperature of the water, the mobility of fish has been reported to increase (Petty et al. 2012) hence the metabolic rate also increases (Xu et al. 2010) until a physiological limit of tolerance is attained. The timing of sample collection plays a vital role because it can help in capturing the presence of the migratory species based on its natural history or seasonal variability in levels of resident species (Lesley et al. 2016). It has been found that with different developmental stages, eDNA released also varied. eDNA release rate per fish body weight is slightly more in the juvenile group when compared to that of an adult group due to factors related to ontogeny. But, the rate of eDNA release per individual is more from adult fish than juveniles because of the larger body size of adult fish (Maruyama et al. 2014). Hence, it is difficult to infer if the source of eDNA is from a higher number of juveniles or a lesser number of adults.

Persistence of eDNA in different environmental conditions

DNA has limited chemical stability (Lindahl 1993) and once it is shed into the environment, it can either persist in free form or get adsorbed to organic or inorganic matter or else get sedimented or degraded (Dejean et al. 2011). The persistence of eDNA depends on factors which are divided into three categories - abiotic (temperature, salinity, pH, oxygen, & light), biotic (extracellular enzyme & microbial community), and DNA characteristics (length, conformation, & membrane-bound) reviewed by Barnes et al. (2014).

Capture protocols for eDNA and sensitivity of the assay

Most efficient capture protocols are a combination of a selection of the most appropriate filter materials which allows filtering the maximum amount of water using powerful automatic motors along with optimized isolation protocols and preservation techniques to maximize the yield of eDNA. The pore size of the filter is also an important feature that decides which source of DNA shall be enriched- gametes, sloughed cells free DNA, etc, and also the target group of organisms. If microorganisms are the target, then very low pore size filters will capture most of them. Renshaw et al. 2015 found that there was no significant difference in copy number in the case of 0.8 µm cellulose nitrate (CN) filter or 0.8 µm polyether sulphone (PES) filters. In contrast to this, (Hinlo et al. 2017) and (Liang & Keeley 2013) found a CN filter to have a significant difference in DNA yield. This difference could be due to a different combination of isolation and preservation protocol.

Precipitation and filtration are the two methods that have been used to extract eDNA from water samples. Precipitation is generally used for smaller volumes by using salt and ethanol to precipitate extracellular DNA by using centrifugal forces (Maniatis et al. 1982). Filtration is more size-dependent and is based on the property of filter material to keep eDNA. Filtration had shown more yield of eDNA in combination with isolation protocols for DNA (Deiner et al. 2015). DNA isolation: three protocols generally have been used to extract DNA from filters, namely the phenol chloroform Isoamyl alcohol method (PCI), Qiagen’s DNeasy® blood and tissue kit, and MoBio’sPowerwater® DNA isolation kit. PCI method has been shown to yield more targeted DNA compared to Qiagen’s DNeasy® blood and tissue kit using a 0.45 µm CN filter. While MoBio’sPowerWater® DNA isolation kit has shown more yield than the PCI method using a 1.5 µm glass membrane filter (GMF) (Renshaw et al. 2015). However, filtration along with Qiagen’s DNeasy ® blood and tissue kit has shown a higher diversity of eukaryotes being detected compared to that of limited species being detected in the case of the PCI method with filtration (Deiner et al. 2015). We believe that skipping the use of lysis buffer during isolation of eDNA from filter membranes will help in reduction of the microbial eDNA part as it will limit the lysis of microbial cell. This method will help in studying the non-microbial or eukaryotic taxa. The flow rate through filters had also been seen as a crucial step, as eDNA might start the process of degradation if the filtration time is too much. Hence, filters with higher flow rates have been preferred (Hinlo et al. 2017).

Preservation of DNA and storage is also a very crucial step in the case of detection of very low abundant species or quantification of the abundance of any species, as even a slight degradation in copy numbers might give faulty results. Freezing of filters at a very low temperature cannot always be workable in field conditions hence 95% ethanol (Minamoto et al. 2015), Longmire buffer (Renshaw et al. 2015; Williams et al. 2016), and CTAB (Renshaw et al. 2015) has been shown as alternatives. It was found that both the Longmire buffer and CTAB preserved filtered eDNA for over two weeks at 20˚C but at 45˚C Longmire, buffer outperformed CTAB buffer (Renshaw et al. 2015). Enhanced CTAB buffer has shown to have better inhibitor removal activity while Longmire buffer has the property to preserve eDNA for a longer time (Hunter et al. 2019). It is recommended to choose the best preservation buffer according to one’s requirement by conducting a pilot experiment.

PCR inhibitors can be responsible for incorrect estimation of abundance or failure in the detection of very low copy number species. These inhibitors can either be co-extracted along with the extraction of eDNA or during isolation protocols. These inhibitors, like phenol and proteinase K, are removed by adding BSA to the PCR master mix (Deiner et al. 2015). These inhibitors might also be removed using inhibitor removal columns available in some commercial kits (McKee et al. 2015).

The specificity of primer and sensitivity of PCR is crucial. Nested PCR has been shown to improve detection compared with conventional PCR (Jackson et al. 2017). Detection rates of eDNA are greater with digital droplet PCR (ddPCR) than real-time PCR (qPCR) at lower concentrations (Doi et al. 2015). Quantitative estimation of biomass was shown to be more accurate by using ddPCR than qPCR. ddPCR was suitable for measurement of the natural sample as inhibitory substances have little effect on DNA quantification, as endpoint PCR amplification in each droplet can be detected independent of amplification efficiency in ddPCR (Doi et al. 2015). There have been reports that base pair mismatches in the primer have more impact than that of the probe and the location of the mismatch also plays an important role. Base pair mismatch near the 3’ end has shown a larger impact on specificity than in the 5’ end or any other region (Wilcox et al. 2013).

Applications of eDNA as a tool in conservation and biodiversity monitoring

From deciphering single species to documenting entire communities, our understanding of eDNA study has progressed over the years. There is a multitude of applications of eDNA ranging from detection of invasive species, elusive species or any other ecologically important or threatened species to unravelling community dynamics and their response to changing spatial-temporal changes. This has paved new avenues in ecosystem management. In the case of microbes, less than two per cent of the total are culturable (Wade 2002). This necessitates the implementation of culture-independent methods for understanding their genomic and functional aspects . The eDNA technique has found a host of new applications over several years in the field of ecosystem monitoring and management.

Detection of species

Its advent revolved around the uncovering of single species like the detection of invasive species, Crayfish Procambarus clarkia (Geerts et al. 2018), endangered or vulnerable species, Wood Turtle Glyptemys insculpta (Lacoursière-Roussel et al. 2016c), or some elusive species, Oriental Weather Loach Misgurnus anguillicaudatus (Hinlo et al. 2017). A brief methodology for the detection of species from environmental aquatic samples using the eDNA method has been depicted in Image 1. eDNA technology along with occupancy modelling has been utilised for monitoring the presence of endangered species of Northern Tidewater Goby species Eucyclogobius newberryi and Southern Tidewater Goby species Eucyclogobius kristinae across the entire coast of 1,350 km (Sutter & Kinziger 2019). They found that eDNA technology showed double the rate of detection compared to the seining method, which resulted in improved site occupancy estimates as Northern Tidewater Goby was detected at two sites where their presence was never known before. A positive correlation was observed between eDNA concentration and catch per unit effort (CPUE). The implication of such objectives paves the path towards improved conservation goals. A list of key studies, along with the primers used in the detection and monitoring of different species, is summarised in Table 2.

2) Population genetics studies

Population genetics has been a significant aspect in the study of ecology as it gives information about evolutionary history. But, research in this sector with the use of eDNA has just begun and is in its initial stage. Sampling in the case of population genetics has been a major challenge, especially in threatened organisms. eDNA approach helps to mitigate such challenges and helps in the study of organisms that are difficult to sample. Researchers have used eDNA that was extracted from sea water to examine the haplotype frequencies and genetic diversity at population level in Whale Shark Rhincodon typus (Sigsgaard et al. 2017). They used high throughput sequencing of two mitochondrial control region sequences and compared it with tissue samples from 61 individuals at the same locality from when samples for eDNA were collected. It was found that relative frequencies in both were similar. The more current study of elusive Harbour Porpoise Phocoena phocoena used high throughput sequencing for studying haplotype diversity and found eight unique mitochondrial DNA sequences from seawater sampling (Parsons et al. 2018). In another study, species and ecotypes of Killer Whales (Orcinus orca were identified following encounters using digital droplet PCR and subsequently were sequenced. It was identified that the killer whale encounter was from a southern resident community (Baker et al. 2018). In a more recent study by Stepien et al. (2019), Silver Carp Hypophthalmichthys molitrix which is an invasive species in the U.S was studied for its introduction and spread using eDNA and mitochondrial markers targeting cytochrome b and c oxidase and nuclear DNA microsatellite markers.

3) Estimation of relative abundance

The scope of eDNA is more than just detecting the presence/absence of an organism. Estimation of copy number or biomass has been the major focus and extrapolation of avenues in which an eDNA study can be helpful. The information about an organism’s relative abundance in the spatial-temporal scale helps to document the seasonal variations due to its response to the environment or due to other external forces like inter or intra-species competition. Estimation of abundance can have economic value in aquaculture if yield in a particular season can be known beforehand by studying the history of a few years about its seasonal variations. Even though numerous factors play a role in the persistence of eDNA in the environment along with its polydisperse nature, as discussed in the earlier section, if all protocols related to filtrations, isolation, and preservation are followed the same way for all samples across all seasons, then it can give an insight of its relative abundance. eDNA concentration of Lake Trout Salvelinus namaycush was estimated in 12 natural lakes and its abundance was compared to that of standardized gill net catches (catch per unit effort -CPUE and Biomass per unit effort- BPUE (Lacoursière-Roussel et al. 2016a) . Another study showed that the eDNA released from the target organism is a measure of its biomass for which laboratory and field-based experiments were conducted on Common Carp. This highlighted that the concentration of eDNA positively correlated to its biomass and can serve to understand its distribution in natural systems (Takahara et al. 2013).

An endangered amphidromous fish, Ryukyu ayu Plecoglossus altivelis ryukyuensis, was monitored to estimate abundance using qPCR with specific primers to amplify the mtDNA ND4 region. The visual snorkelling surveys by individually fish counting positively correlated to eDNA copies/ml (Akamatsu et al. 2020). In another recent study by (Capo et al. 2019), digital droplet PCR was used to detect as well as quantify Brown Trout Salmo trutta and Arctic Char Salvelinus alpinus populations. While they compared between fish population estimated by conventional Catch per unit effort (CPUE) from gill netting method and eDNA concentration from digital droplet PCR, no significant correlation could be deduced, yet this paves a promising path for future research in this aspect by focussing on challenges and limitations which need to be overcome. This study also focuses on probable problems of stand-alone methods and how a congregation of various approaches, together with optimised protocols, can yield the desired result. In another method of individual estimation in a population, a novel NGS based strategy was used which counted haplotypes in the mitochondrial D-loop sequence of eel. This method was named HaCeD-Seq and it was claimed to be better and more accurate in quantification than conventional qPCR. However, its accuracy decreased when the number of individuals increased because of lesser unique haplotypes and more overlap of sequence among individuals (Yoshitake et al. 2019). A much deeper understanding of factors affecting the abundance of eDNA copies in natural environments can help to boost this technology and can be of extreme importance, especially in fisheries management and has direct implications on increasing its economic value.

Though there are substantial volumes of research in this field of eDNA our understanding is still limited. There have been enormous volumes of reports concerning the release and persistence of eDNA in various environments, but there has been no noticeable research on the effect of stressed environments like human activities or predation pressure on the release rate of eDNA and how it brings changes in our overall understanding of species abundance.

4) Studying the communities in the ecosystem:

Holistic study of ecosystem and metabarcoding gives more inferential insights and hence an upheaval in the use of eDNA has led to transitioning from DNA barcoding to metabarcoding, hence from studying single species to communities and their interactions. This in turn has enabled extracting more information and data using less time and manpower under field conditions.

Understanding ecosystem health in aquatic bodies

In the last few years, a new paradigm has got an increasing focus that aids in the understanding of the health of ecosystems using metabarcoding. This can be accomplished by establishing the link between changing abiotic factors and the ecology of the ecosystem to that of changing biotic interactions among communities inferred from metabarcoding data. Eutrophication is a process of enrichment of nutrients like nitrogen and phosphorus (Conley et al. 2009) in water bodies. Although natural eutrophication occurs at a very slow pace due to the ageing of water bodies (Carpenter 1981), in the past century cultural eutrophication due to anthropogenic actions has led to rapid nutrient efflux into the water bodies (Smith 1998). Eutrophication is one of the major indicators of anthropogenic means of changing the physicochemical parameters of aquatic bodies along with the construction of dams, channelisation and sediment transport as depicted in Image. 2 (Bianchi & Morrison 2018). This can change the biological productivity and community structure composition of the water bodies (Sawyer 1966). There are manifold effects of eutrophication, algal blooms being the most noticeable of them. The change in Nitrogen (N): Phosphorus (P) ratio or dissolved organic carbon (DOC): dissolved organic nitrogen (DON) has been found as a variable in case of such blooms (Anderson et al. 2002). The major component of these blooms is Cyanobacteria and they produce cyanotoxins which act as neurotoxins and hepatotoxins for fishes, mammals and also humans (Oberemm et al. 1999; Carmichael 2001). Literature search shows that though there are some studies in this area using metabarcoding to find the community structure of bacteria and planktons (Wan et al. 2017; Banerji et al. 2018) in aquatic systems, we find very few studies relating how anthropogenic disturbances might affect the ecosystem services.

One such study by (Craine et al. 2017), showed the relation among the changing environmental variables like dissolved nutrient concentration with four taxonomic groups namely bacteria, phytoplankton, invertebrates, and vertebrates. Further, they found that increasing eutrophication of nutrients and river size were the crucial variables that changed the abundances of these broad taxa. Clark et al. (2020) demonstrated the impact of enrichment with fertilizers on the benthic communities in two estuaries that differed in its environmental attributes. The effect was studied using eDNA metabarcoding on bacterial (16sRNA), eukaryotic (18sRNA) and diatom only (rbcL) communities after seven months of nutrient enrichment. They found that there were clear changes in the case of bacterial and eukaryotic taxa but more obscure in the case of diatoms. Also, they found that these changes could be observed within 150 g N m-2 of fertiliser treatment, suggesting that early signs of ecosystem degradation could be studied and the restoration process could be initiated using such shifts in the structure of communities as cues. Such methods were used initially for species detection and quantification, now it has been used for ecosystem assessment and monitoring for its health. The focus on studying community structure as a measure of predicting ecosystem health has advantages as it brings about a holistic view of the same and helps acknowledge the fact how species interdependency is linked to abiotic factors as well. One such study in this regard was by Yang & Zhang (2020), where they used zooplankton community to assess the quality of the ecosystem. They showed across three seasons, i.e., dry, normal and wet, the species detected remained the same but their relative abundances changed at the temporal scale. The study also emphasised that though eDNA based abundance studies are the semi-quantitative presence of species along with changing relative abundances of indicator zooplankton species at spatial-temporal scale. The water quality index correlated with 60 different zooplankton indices which were both qualitative and quantitative. But such correlations need not always be direct/correct due to other confounding factors like interaction with other species communities, which in turn influence the zooplankton community. Such studies aren’t limited to only aquatic systems but also have seen recent applications in analysing sediment pollution from coastal regions at a spatiotemporal scale. In a study by Lee et al. (2020), the changes in microbial diversity at phylum level showed variation concerning 13 environmental variables of sediment pollution and toxicity. Although certain phyla remained dominant others showed shifts in community structure.

Whole-genome or metagenome-assembled-genomes (MAGs) based studies

Most of the above-mentioned studies are based on the amplification of the universal marker regions of DNA or amplicon-based 16sRNA sequencing and can have bias during PCR (Jovel et al. 2016). They are based on the single-gene approach of identification of its taxa. One way to solve this is to bring in a multi-gene or whole genome-based taxonomic approach. This also helps in functional prediction of genes like those involved in the biogeochemical cycling by microorganisms and can be of great significance in studying ecosystem services. Another method used in recent times to study taxonomy based on phylogenetic reconstruction is by assembling the metagenomes also called metagenome-assembled genomes (MAGs) and is of immense importance in culture-independent microbial molecular studies. In a study by Tran et al. (2021), the role of specific taxa of microbes in biogeochemical processes in the lake, they had assembled 24 samples individually by de novo method and generated 24 MAGs which were then binned, then finally used for the construction of concatenated gene phylogeny using single-copy ribosomal proteins. They found that MAGs showed an abundant genomic capacity for nitrogen and sulphur cycling. In another similar work by Reji & Francis (2020), MAGs were constructed for a lineage of Thaumarchaeota, a phylum of Archaea from the marine ecosystem. This lineage seemed to be devoid of genomic repertoire only for chemoautotrophy as it did not have ammonia-oxidising machinery and other pathways related to the same as in other archaeal lineages. This highlights the metabolic diversity among the microbial communities for nutrient acquisition and processing, which is generally not possible in the case of culture-dependent molecular studies as most of the bacteria are non-culturable.

We find studies in eDNA are becoming broader in perspective rather than only species detection, but this holds much more potential in coming years in terms of answering some basic ecological questions about the effect of anthropogenic disturbances that lead to changes in abiotic factors of an ecosystem which changes community structure composition at spatial and temporal scales and threatens ecosystem services and ecosystem health.

Also, there has been very little emphasis on understanding the functional role of eDNA studies i.e., how it can be used to compare eDNA and eRNA and decipher the active constituent of the genome which might have an important role in ecological functioning like genes responsible for biogeochemical cycling of various nutrients in nature. Since RNA has lesser stability than DNA, it is a better and more reliable measure for studying the presence of an organism or its abundance and hence has been used in forensic science to estimate the time since deposition of biological material (Bremmer et al. 2012).

Technical Challenges of eDNA-based methods

Although eDNA technology has provided a plethora of its applications and helped to understand nature in a holistic view, it still suffers from a few challenges which require more refinement and troubleshooting.

PCR Bias

The foremost problem arises in the estimation of relative abundance using a metabarcoding approach where PCR bias serves as a major issue. Those taxa having organisms that are not affected by seasonal variations and are more abundant in number having high dispersal ability tend to be over-represented during sampling than sedentary and seasonal ones. Even the copy number of target loci may vary among taxa, individuals, or tissue types. There can be several possibilities that can cause bias in PCR amplification during metabarcoding. PCR is a stochastic process hence can become a source of bias like the number of PCR cycles, mismatch in primer binding site, annealing temperature, secondary structures in template DNA, multiple templates in the sample, more selectivity of primers for some specific taxa and copy number of target loci (Pinto & Raskin 2012; Elbrecht & Leese 2015; Fonseca 2018). Nichols et al. (2018), showed that polymerase can show bias toward GC sequence and can alter the relative abundance of molecules dramatically during metabarcoding and that this bias can be removed experimentally using a molecular identifier (MID) where starting material is disambiguated bioinformatically following PCR.

Unknown source of eDNA

There have been reports of transport of undigested material of higher organisms or their dead carcasses, which gives a false implication of their presence at that particular site (Song et al. 2017).

Problems with single-species detection and bias in eDNA extraction protocols

Single species detection in the marine environment is challenging due to increased dilution, higher salinity, and more intermixing of constituents (Cristescu & Hebert 2018). Higher salt concentration can also inhibit PCR and give false implications about the absence of the target organism. Continuous sample collection either monthly or seasonal depending on the research question might serve as a way to overcome false detections. Enrichment of extracellular DNA can help in reducing the signal from non-target microbial cells as they are more abundant in natural ecosystems.

Chances of false positives and false negatives

False positives errors (Type-I) arise when there is no actual presence of the target organism, but still, it is detected at that site which can be due to contamination issues or problems in PCR optimization or sequencing (Schmidt et al. 2013). The specificity of primers also plays a vital role in minimizing picking up related species having very little sequence variance than the target species. False-negative errors (Type-II) arise when a target organism fails to get detected even though it is present there. This can be attributed to reasons like inefficient sample preservation, faulty sampling practices, or less sensitivity of detection assay in the case of low-abundant organisms.

Measuring the absolute abundance of the species is practically not possible

Factors governing the quantification of eDNA are dependent on countless factors. Many juvenile organisms or a lesser number of adult organisms, might release an equal amount of eDNA. Hence, biomass estimation can be made but estimating abundance can be difficult with PCR-based methods (Elbrecht & Leese 2015). Change in eDNA concentration due to seasonal variation has been reported by many, which can lead to difficulty in estimation of true abundance (Barnes et al. 2014). Maintaining many replicates for PCR and DNA isolation can increase the probability of capturing many taxa by the metabarcoding approach (Leray & Knowlton 2017).

eDNA shedding and decay rates in a particular environment govern the quantification of particular species. In a study by Sassoubre et al. (2016), eDNA decay and shedding rates in seawater mesocosm were assessed for three economically and ecologically important marine fishes- Engraulis mordax (Northern Anchovy), Sardinops sagax (Pacific Sardine), and Scomber japonicas (Pacific Chub Mackerel) by Taqman® qPCR assay. In another similar study, Round Goby Neogobiusme lanostomus, an elusive species, was assessed for the shedding and decay rate of eDNA. eDNA shedding was measured after fixed time intervals, and the effect of temperature on shedding rate was also studied. First order decay constants were calculated and the decay rate was found to be slightly lower in cold water than in warm water. A most significant part of the study was that a positive correlation between eDNA concentration and the number of round gobies collected using two capture methods could be established (Nevers et al. 2018). Knowledge about these factors together with factors affecting abundance can act as a lead in abundance estimation studies. The effect of various environmental factors affecting the persistence of eDNA and indirectly the abundance has been shown by (Barnes et al.2014).

Potential solutions to the challenges:

We have developed a few reflections that might be helpful for future eDNA research:

PCR- free methods

As mentioned in the previous section, PCR introduces several kinds of biases. Hence developing a new methodology to overcome this step during the metabarcoding approaches can be of immense value in future. Following the same optimized capture and isolation protocols for all collected samples along with maintaining appropriate controls, increasing the number of replicates at each site of sample collection, seasonal collection of samples at the same points throughout the year and developing of PCR-free approach can help to give a picture of near-absolute abundance of organisms. Manu & Umapathy (2021), designed a novel metagenomic workflow which used PCR-free library preparation during Next-generation sequencing (NGS) and performed an ultra-deep sequencing and pseudo taxonomic assignment to get the biodiversity of an ecosystem across the entire tree of life.

Source of eDNA can be both from live and dead organisms: In aquatic systems, transport of eDNA has been observed for tens of kilometres (Andruszkiewicz et al. 2019), hence mere detection of eDNA at a particular time neither confirms the exact location nor the source since eDNA can persist in systems for approximately 48 hours (Collins et al. 2018). A probable way of accounting for this issue is by an increase in both the number of biological and technical replicates as well as sampling continuously for a minimum of three days at the same locations which might add more confidence to the data acquired.

Sampling criteria, filtration of samples and isolation of eDNA protocols

It should be based on the research question. The standardisations of all the protocols should consider the main hypothesis of the research. For example, if the purpose of the research question is only addressed towards deciphering prokaryotic diversity, then all the protocols should be tweaked to get enriched eDNA from that community and also to get maximum diversity of that taxa. This might help to get a better and more focused results. The enrichment of extracellular DNA should be targeted if the question needs studying the entire biodiversity of the system.

Reducing false positives and false negatives

It has been reported that increasing the number of replicates during PCR can minimize the chances of false negatives. The inclusion of positive control during PCR can help check the optimization of PCR conditions. To limit the detection of false absence, the number of replicates should be a minimum of six for a detection probability of 0.5, and for even lower detection probability, a minimum of eight replicates are needed (Ficetola et al. 2015). When both detection probability and the number of replicates has been too low, it was found that this underestimated occupancy and overestimated the detection rate (Ficetola et al. 2015).

Only relative abundance can be quantified

Since eDNA yield depends on the developmental stage and size of an individual (Petty et al. 2012), mesocosm or aquarium-based studies can be standardised for a particular developmental stage or size of an individual of a species to get an estimate of the actual number of individuals, but mimicking natural environmental conditions of an ecosystem is very difficult and prone to errors. Also, since every ecosystem has its own abiotic and biotic features, the results might not be reproducible.

Conclusion

The use of eDNA and its multitude of applications has become a fast-developing area. This outpour comes in the light of the increasing need to monitor changes in our environment and how living organisms are affected by them. This helps to have better conservation focus on regions or species of special importance. In this era of unprecedented climate change and the concerns possessed by it, eDNA can help assist in the monitoring of biodiversity alongside other conventional methods to yield better results. Any new technology calls for new challenges and room for improvement, so is with eDNA where chances of contamination and bias for the detection of abundant species are higher. But with more stringent methodology and computational advancements, the risks are getting minimised. It has the potential to answer many deeper questions of research in this area.

Table 1. Few key studies on the applications of eDNA as a tool.

	Study details	References
Detection of species:
1)	Detection of alien invasive species Procambarus clarkii (crayfish) in water from the natural pond and artificial aquarium	(Geerts et al. 2018)
2)	Detection of a threatened species Glyptemys insculpta (wood turtle) using qPCR by designing species-specific primers and Taq man probe	(Lacoursière-Roussel et al. 2016c)
3)	Detection of endangered Shasta crayfish (Pacifastacus fortis) and invasive crayfish (Pacifastacus leniusculus) in river water	(Cowart et al. 2018)
4)	Comparing the sensitivity of detection of alien invasive species- American bullfrog (Lithobates catesbeianus)	(Dejean et al. 2012)
5)	Detection of invasive species, African jewelfish (Hemichromis letourneuxi) and determine the lower limit of detection and effect of fish density and time on detection in an artificial aquarium	(Díaz-Ferguson et al. 2014)
6)	Detection of invasive species, New Zealand mud snails (Potamopyrgus antipodarum) and to find the time till which eDNA remains detectable in the aquatic system	(Pilliod et al. 2013a)
7)	Detection of invasive submerged aquatic plant, Egeria densa in pond water	(Fujiwara et al. 2016)
8)	Differentiating between endemic species, Japanese giant salamander (Andrias japonicum) and exotic species, Chinese giant salamander (Andrias davidianus) using eDNA	(Fukumoto et al. 2015)
9)	eDNA detection rate has a positive relationship with flow volume in waterways and has a more pronounced effect on eDNA detection probability than other co-variates like temperature, dissolved oxygen concentration, pH	(Song et al. 2017)
10)	Detection of transient pelagic marine fish, Chilean devil ray (Mobula tarapacana)	(Gargan et al. 2017)
Estimation of biomass/abundance:
1)	Effect of water temperature and eDNA capture method on altering the relationship between eDNA concentration and fish biomass of economically important salmonid, Brook Charr (Salvelinus fontinalis)	(Lacoursière-Roussel et al. 2016b)
2)	Killer whale (Orcinus orca) eDNA quantification using ddPCR from seawater	(Baker et al. 2018)
3)	Estimation of transport distance of eDNA of brown trout (Salmo trutta, L.) using a dual-labelled probe for relative quantification	(Deutschmann et al. 2019)
4)	Comparison of detection probability, density, biomass and occupancy with traditional methods of sampling of Rocky Mountain tailed frog (Ascaphus montanus) and Idaho giant salamander (Dicamptodon aterrimus)	(Pilliod et al. 2013b)
5)	Salmon DNA was measured from water samples during the spawning season using species-specific quantitative PCR probes and factors affecting the correlation between eDNA concentration and biomass of these fishes were also studied.	(Tillotson et al. 2018)
Studying the communities in the ecosystem
1)	The direct impact of an anthropogenic activity like an oil spill on the coastal marine ecosystem was observed. The succession of communities after the event was monitored which included bacteria, metazoans and protists. Certain communities were found to be resistant to the effect of this incidence whereas few others were conferred with the sensitivity to this.	(Xie et al. 2018)
2)	The community-level response in cyanobacteria, diatoms and microbial eukaryotes were correlated to physicochemical parameters of Lake Constance like rising phosphorus and air temperature. Major environmental perturbations like eutrophication during the 20^thcentury were found to align with the reversion of resilience demonstrated by the communities.	(Elberri et al. 2020)
3)	The change in community structure of bacterial, protistan, and metazoan communities in response to pollution status of the river using eDNA metabarcoding. The varying level of nutrients in the ecosystem was shown to be the main driving factor in the relative abundance of OTUs and community structure.	(Li et al. 2018)
4)	The spatial distribution of bacterial communities was studied using metabarcoding. The change in the richness of these communities and the abundance was shown to be a measure of the degree of anthropogenic contamination and can be an area to focus on for biomonitoring of coastal ecosystems.	(Garlapati et al. 2021)
5)	The study focuses on identifying the association between the fish assemblages in the ecosystem and invasive species and how these get affected by environmental co-variates and human-induced disturbance.	(Pukk et al. 2021)

Table 2. Key studies for detection of important species in aquatic ecosystem.

Aim of Study

Primer sequence used in the study

Reference

Detection of invasive rusty crayfish (Orconectes rusticus) in inland lakes using specific qPCR primers targeting the cytochrome c oxidase subunit 1 (COI) sequences

Forward primer

Reverse primer

Amplicon length (in bp)

(Dougherty et al. 2016)

5′-CAGGGGCGTCAGTAGATTTAGGTAT-3′

5′-CATTCGATCTATAGTCATTCCCGTAG-3′

128

Detection of invasive common Atlantic slipper limpet (Crepidula fornicate) from environmental seawater sample using species-specific primers targeting COI gene

Forward primers

Reverse primers

Amplicon length (in bp)

(Miralles et al. 2019)

5′-GATGATCAACTATACAATGTA-3′

5′- TAAACCGTTCAACCGG-3′

239

Detection of invasive signal crayfish (Pacifastacus

Leniusculus) in river and lake water samples using Taqman probe and species-specific primers targeting the COI gene

Forward primer

Reverse primer

Probe

Amplicon length (in bp)

(Harper et al. 2018)

5´-ATAGTTGAA

AGAGGAGTGGGTACT-3´

(5´-TAA

ATCAACAGAAGCCCCTGCA-3´)

FAM-5´-CCTC

CTCTAGCAGCGGCTATTGCTCATGC-3´-BHQ1

Studying the distribution of silver carp (Hypophthalmichthys molitrix) and developing of novel methodology for on-site detection of the species

Forward primer

Reverse primer

Probe

(Doi et al. 2021)

5′-GCAATTAACTTCATCACCACAACTATTA-3′

5′-TCCAGCAGCTAAAACTGGTAAGG-3′

5′-[FAM]-AAACACCTCTCTTTGTTTGAGCTGTGC-[TAMRA]-3′

Detection and quantification of European weather loach (Misgurnus fossilis) using digital droplet PCR targeting the COI gene. This species is cryptic and is facing population decline in recent times.

Forward primer

Reverse primer

Probe

Amplicon length (in bp)

(Brys et al. 2021)

5’-CCCCCGACATAGCATTTCCG-3’

5’-AACTGTTCAGCCTGTCCCAG-3’

5’- (6-FAM)CTCGTTCCTCCTTCTGCTGG(ZEN/IBFQ)-3’

119

Detection of endangered freshwater or Spectacle case Mussel (Margaritifera monodonta) using species-specific qPCR primers.

Forward primer

Reverse primer

Probe

(Lor et al. 2020)

5’-AGTGGGTGATACCWGTATCT-3’

5’-TACCCCTAGCACCATTTGAT-3’

5’-5HEX/TCTAGCCCT/ZEN/AAGACTATGACAACTTTTCC/3IABkFQ-3’

Monitoring of river systems for detection of invasive Eastern mosquitofish (Gambusia holbrooki) and the consequent decline of two endemic species of killifish (Valencia letourneuxi and Valencia robertae) using species-specific qPCR targeting the COI region.

Species

Forward primer (5’−3’)

Reverse primer (5’−3’)

Probe (5’−3’)

Amplicon length (in bp)

(Mauvisseau et al. 2020)

Valencia letourneuxi

TGGGGGTTTTGGCAACTGAC

GGAGGAGAAGAAACGAGGGGGG

CATAGCCTTCCCTCGGATAAAC

113

Valencia robertae

ATGGCCTTCCCCCGAATGAA

GCTAAGTTTCCGGCCAGAGG

CTTCCTCTGGCGTCGAGGC

137

Gambusia holbrooki

GTGCCCCAGACATAGCCTTT

TACAGAAGGTCCGGCATGTG

AAGATGCGAGGAGGAGGAGA

167

Detection of endangered Hay’s Spring Amphipod (Stygobromus hayi) and a co-occurring species of S. tenuis potomacus in groundwater using species-specific qPCR targeting the COI region.

Species

Forward primer (5’-3’)

Reverse primer (5’-3’)

Probe (5’-3’)

(Niemiller et al. 2018)

Stygobromus hayi

GCATCTGTCGACTTAGCTATT

CGGCACTTGGTCTATAGTTATT

6-FAM-TCACTTCATTTAGCAGGAGCCTCCTC-TAMRA

S. tenuis potomacus

CTGAACAGTATATCCACCACT

CATTCCAGGTCTCCGTATATT A

-6-FAM-TGCAGTAGCCCATAGTGGAGCATCT-TAMRA

For images - - click here

References

Akamatsu, Y., G. Kume, M. Gotou, T. Kono, T. Fujii, R. Inui & Y. Kurita (2020). Using environmental DNA analyses to assess the occurrence and abundance of the endangered amphidromous fish Plecoglossus altivelis ryukyuensis. Biodiversity Data Journal 8 :e39679. https://doi.org/10.3897/BDJ.8.e39679

Andruszkiewicz, E.A., J.R. Koseff, O.B. Fringer, N.T. Ouellette, A.B. Lowe, C.A. Edwards & A.B. Boehm (2019). Modeling environmental DNA transport in the coastal ocean using Lagrangian particle tracking. Frontiers in Marine Science 6: 477. https://doi.org/10.3389/fmars.2019.00477

Baker, C.S., D. Steel, S. Nieukirk & H. Klinck (2018). Environmental DNA (eDNA) from the wake of the whales: Droplet digital PCR for detection and species identification. Frontiers in Marine Science 5: 1021. https://doi.org/10.3389/fmars.2018.00133

Barnes, M.A. & C.R. Turner (2016). The ecology of environmental DNA and implications for conservation genetics. Conservation Genetics 17(1): 1–17. https://doi.org/10.1007/s10592-015-0775-4

Barnes, M.A., C.R. Turner, C.L. Jerde, M.A Renshaw, W.L Chadderton & D.M. Lodge (2014). Environmental conditions influence eDNA persistence in aquatic systems. Environmental Science and Technology 48(3): 1819–1827. https://doi.org/10.1021/es404734p

Bianchi, T. & E. Morrison (2018). Human Activities Create Corridors of Change in Aquatic Zones. Eos 99(11): 13–15. https://doi.org/10.1029/2018eo104743

Bremmer, R.H., K.G. De Bruin, M.J.C. Van Gemert,, T.G. Van Leeuwen & M.C.G Aalders (2012). Forensic quest for age determination of bloodstains. Forensic Science International 216(1–3): 1–11. https://doi.org/10.1016/j.forsciint.2011.07.027

Brys, R., D. Halfmaerten, S. Neyrinck, Q. Mauvisseau, J. Auwerx, M. Sweet & J. Mergeay (2021). Reliable eDNA detection and quantification of the European weather loach (Misgurnus fossilis). Journal of Fish Biology 98(2): 399–414. https://doi.org/10.1111/jfb.14315

Capo, E., G. Spong, S. Norman, H. Königsson, P. Bartels & P. Byström (2019). Droplet digital PCR assays for the quantification of brown trout (Salmo trutta) and Arctic char (Salvelinus alpinus) from environmental DNA collected in the water of mountain lakes. PLoS ONE 14(12): 1–19. https://doi.org/10.1371/journal.pone.0226638

Carmichael, W.W. (2001). Health Effects of Toxin-Producing Cyanobacteria: “The CyanoHABs.” Human and Ecological Risk Assessment: An International Journal Human and Ecological Risk Assessment 7(5): 1393–1407. https://doi.org/10.1080/20018091095087

Carpenter R.S. (1981). The American Naturalist. The American Naturalist 118(3): 372–383.

Clark, D.E., C.A. Pilditch, J.K. Pearman, J.I. Ellis & A. Zaiko (2020). Environmental DNA metabarcoding reveals estuarine benthic community response to nutrient enrichment – Evidence from an in-situ experiment. Environmental Pollution 267: 115472. https://doi.org/10.1016/j.envpol.2020.115472

Collins, R.A., O.S. Wangensteen, E.J. O’Gorman, S. Mariani, D.W. Sims & M.J. Genner (2018). Persistence of environmental DNA in marine systems. Communications Biology 1(1): 1–11. https://doi.org/10.1038/s42003-018-0192-6

Conley, D.J., H.W. Paerl, R.W. Howarth, D.F. Boesch, S.P. Seitzinger, K.E. Havens, C. Lancelot & G.E. Likens (2009). Controlling eutrophication: phosphorus and nitrogen. Science 323: 1014–1015.

Cowart, D.A., K.G.H Breedveld, M.J. Ellis, J.M. Hull & E.R. Larson (2018). Environmental DNA (eDNA) applications for the conservation of imperiled crayfish (Decapoda: Astacidea) through monitoring of invasive species barriers and relocated populations. Journal of Crustacean Biology 38(3): 257–266. https://doi.org/10.1093/jcbiol/ruy007

Craine, J., M. Cannon, A. Elmore, S. Guinn & N. Fierer (2017). DNA metabarcoding potentially reveals multi-assemblage eutrophication responses in an eastern North American river. BioRxiv 186452. https://doi.org/10.1101/186452

Cristescu, M.E. & P.D.N. Hebert (2018). Uses and misuses of environmental DNA in biodiversity science and conservation. Annual Review of Ecology, Evolution, and Systematics 49: 209–230. https://doi.org/10.1146/annurev-ecolsys-110617-062306

Deiner, K., J.C. Walser, E. Mächler & F. Altermatt (2015). Choice of capture and extraction methods affect detection of freshwater biodiversity from environmental DNA. Biological Conservation 183: 53–63. https://doi.org/10.1016/j.biocon.2014.11.018

Dejean, T., A. Valentini, A. Duparc, S. Pellier-Cuit, F. Pompanon, P. Taberlet & C. Miaud (2011). Persistence of environmental DNA in freshwater ecosystems. PLoS ONE 6(8): 8–11. https://doi.org/10.1371/journal.pone.0023398

Dejean, T., A. Valentini, C. Miquel, P. Taberlet, E. Bellemain & C. Miaud (2012). Improved detection of an alien invasive species through environmental DNA barcoding: The example of the American bullfrog Lithobates catesbeianus. Journal of Applied Ecology 49(4): 953–959. https://doi.org/10.1111/j.1365-2664.2012.02171.x

Deutschmann, B., A.K. Müller, H. Hollert & M. Brinkmann (2019). Assessing the fate of brown trout (Salmo trutta) environmental DNA in a natural stream using a sensitive and specific dual-labelled probe. Science of the Total Environment 655: 321–327. https://doi.org/10.1016/j.scitotenv.2018.11.247

Díaz-Ferguson, E., J. Herod, J. Galvez & G. Moyer, G (2014). Development of molecular markers for eDNA detection of the invasive African jewelfish (Hemichromis letourneuxi): A new tool for monitoring aquatic invasive species in National Wildlife Refuges. Management of Biological Invasions 5(2): 121–131. https://doi.org/10.3391/mbi.2014.5.2.05

Doi, H., K. Uchii, T. Takahara, S. Matsuhashi, H. Yamanaka & T. Minamoto (2015). Use of droplet digital PCR for estimation of fish abundance and biomass in environmental DNA surveys. PLoS ONE 10(3): 1–11. https://doi.org/10.1371/journal.pone.0122763

Doi, H., T. Watanabe, N. Nishizawa, T. Saito, H. Nagata, Y. Kameda, N. Maki, K. Ikeda & T. Fukuzawa, T (2021). On-site environmental DNA detection of species using ultrarapid mobile PCR. Molecular Ecology Resources 21(7): 2364–2368. https://doi.org/10.1111/1755-0998.13448

Anderson, D.M., P.M. Glibert & J.M. Burkholder (2002). Harmful algal blooms and eutrophication: nutrient sources, composition, and consequences. Estuaries 25(4): 704–726.

Dougherty, M.M., E.R. Larson, M.A. Renshaw, C.A. Gantz, S.P. Egan, D.M. Erickson & D.M. Lodge (2016). Environmental DNA (eDNA) detects the invasive rusty crayfish Orconectes rusticus at low abundances. Journal of Applied Ecology 53(3): 722–732. https://doi.org/10.1111/1365-2664.12621

Elberri, A.I., A. Galal-Khallaf, S.E. Gibreel, S.F. El-Sakhawy, I. El-Garawani, S. El-Sayed Hassab ElNabi & K. Mohammed-Geba (2020). DNA and eDNA-based tracking of the North African sharptooth catfish Clarias gariepinus. Molecular and Cellular Probes 51: 101535. https://doi.org/10.1016/j.mcp.2020.101535

Elbrecht, V. & F. Leese (2015). Can DNA-based ecosystem assessments quantify species abundance? Testing primer bias and biomass-sequence relationships with an innovative metabarcoding protocol. PLoS ONE 10(7): 1–16. https://doi.org/10.1371/journal.pone.0130324

Ficetola, G.F., J. Pansu, A. Bonin, E. Coissac, C. Giguet-Covex, M. De Barba, L. Gielly, C.M. Lopes, F. Boyer, F. Pompanon, G. Rayé & P. Taberlet (2015). Replication levels, false presences and the estimation of the presence/absence from eDNA metabarcoding data. Molecular Ecology Resources 15(3): 543–556. https://doi.org/10.1111/1755-0998.12338

Fonseca, V. G (2018). Pitfalls in relative abundance estimation using edna metabarcoding. Molecular Ecology Resources 18(5): 923–926. https://doi.org/10.1111/1755-0998.12902

Fujiwara, A., S. Matsuhashi, H. Doi, S. Yamamoto & T. Minamoto (2016). Use of environmental DNA to survey the distribution of an invasive submerged plant in ponds. Freshwater Science 35(2): 748–754. https://doi.org/10.1086/685882

Fukumoto, S., A. Ushimaru & T. Minamoto (2015). A basin-scale application of environmental DNA assessment for rare endemic species and closely related exotic species in rivers: A case study of giant salamanders in Japan. Journal of Applied Ecology 52(2): 358–365. https://doi.org/10.1111/1365-2664.12392

Gargan, L.M., T. Morato, C.K. Pham, J.A. Finarelli, J.E.L Carlsson & J. Carlsson (2017). Development of a sensitive detection method to survey pelagic biodiversity using eDNA and quantitative PCR: a case study of devil ray at seamounts. Marine Biology 164(5): 1–9. https://doi.org/10.1007/s00227-017-3141-x

Garlapati, D., B.C. Kumar, C. Muthukumar, P. Madeswaran, K. Ramu & M.V.R. Murthy (2021). Assessing the in situ bacterial diversity and composition at anthropogenically active sites using the environmental DNA (eDNA). Marine Pollution Bulletin 170: 112593. https://doi.org/10.1016/j.marpolbul.2021.112593

Geerts, A.N., P. Boets, S. Van den Heede, P. Goethals & C. Van der heyden (2018). A search for standardized protocols to detect alien invasive crayfish based on environmental DNA (eDNA): A lab and field evaluation. Ecological Indicators 84: 564–572. https://doi.org/10.1016/j.ecolind.2017.08.068

Gunzburger, M.S (2007). Evaluation of seven aquatic sampling methods for amphibians and other aquatic fauna. Applied Herpetology 4(1): 47–63. https://doi.org/10.1163/157075407779766750

Harper, K.J., N.P. Anucha, J.F. Turnbull, C.W. Bean & M.J. Leaver (2018). Searching for a signal: Environmental DNA (eDNA) for the detection of invasive signal crayfish, Pacifastacus leniusculus (Dana, 1852). Management of Biological Invasions 9(2): 137–148. https://doi.org/10.3391/mbi.2018.9.2.07

Hinlo, R., D. Gleeson, M.Lintermans & E.Furlan (2017). Methods to maximise recovery of environmental DNA from water samples. PLoS ONE 12(6): 1–22. https://doi.org/10.1371/journal.pone.0179251

Hunter, M.E., J.A. Ferrante, G. Meigs-Friend & A. Ulmer (2019). Improving eDNA yield and inhibitor reduction through increased water volumes and multi-filter isolation techniques. Scientific Reports 9(1): 1–9. https://doi.org/10.1038/s41598-019-40977-w

Jackson, M., C. Myrholm, C. Shaw & T. Ramsfield (2017). Using nested PCR to improve detection of earthworm eDNA in Canada. Soil Biology and Biochemistry 113: 215–218. https://doi.org/10.1016/j.soilbio.2017.06.009

Jiao, N.Z., D.K. Chen, Y.M. Luo, X.P. Huang, R. Zhang, H.B. Zhang, Z.J. Jiang & F. Zhang (2015). Climate change and anthropogenic impacts on marine ecosystems and countermeasures in China. Advances in Climate Change Research 6(2): 118–125. https://doi.org/10.1016/j.accre.2015.09.010

Jovel, J., J. Patterson, W. Wang, N. Hotte, S. O’Keefe, T. Mitchel, T. Perry, D. Kao, A.L. Mason, K.L. Madsen & G.K.S. Wong (2016). Characterization of the gut microbiome using 16S or shotgun metagenomics. Frontiers in Microbiology 7: 459. https://doi.org/10.3389/fmicb.2016.00459

Lacoursière-Roussel, A., G. Côté, V. Leclerc & L. Bernatchez (2016a). Quantifying relative fish abundance with eDNA: a promising tool for fisheries management. Journal of Applied Ecology 53(4): 1148–1157. https://doi.org/10.1111/1365-2664.12598

Lacoursière-Roussel, A., M. Rosabal & L. Bernatchez (2016b). Estimating fish abundance and biomass from eDNA concentrations: variability among capture methods and environmental conditions. Molecular Ecology Resources 16(6): 1401–1414. https://doi.org/10.1111/1755-0998.12522

Lacoursière-Roussel, A., Y. Dubois, E. Normandeau & L. Bernatchez (2016c). Improving herpetological surveys in eastern North America using the environmental DNA method1. Genome 59(11): 991–1007. https://doi.org/10.1139/gen-2015-0218

Lee, A.H., J. Lee, J. Noh, C. Lee, S. Hong, B.O. Kwon, J.J. Kim & J.S. Khim (2020). Characteristics of long-term changes in microbial communities from contaminated sediments along the west coast of South Korea: Ecological assessment with eDNA and physicochemical analyses. Marine Pollution Bulletin 160: 111592. https://doi.org/10.1016/j.marpolbul.2020.111592

Leray, M. & N. Knowlton (2017). Random sampling causes the low reproducibility of rare eukaryotic OTUs in Illumina COI metabarcoding. PeerJ 3: 1–27. https://doi.org/10.7717/peerj.3006

Li, F., Y. Peng, W. Fang,, F. Altermatt., Y. Xie, J. Yang & X. Zhang (2018). Application of Environmental DNA Metabarcoding for Predicting Anthropogenic Pollution in Rivers. Environmental Science and Technology 52(20): 11708–11719. https://doi.org/10.1021/acs.est.8b03869

Liang, Z. & A. Keeley (2013). Filtration recovery of extracellular DNA from environmental water samples. Environmental Science and Technology 47(16): 9324–9331. https://doi.org/10.1021/es401342b

Lor, Y., T.M. Schreier, D.L. Waller & C.M. Merkes (2020). Using environmental dna (eDNA) to detect the endangered spectaclecase mussel (margaritifera monodonta). Freshwater Science 39(4): 837–847. https://doi.org/10.1086/71167

Manu, S. & G. Umapathy (2021). A Novel Metagenomic Workflow for Biomonitoring across the Tree of Life using PCR-free Ultra-deep Sequencing of Extracellular eDNA. Authorea Preprints.

Maruyama, A., K. Nakamura, H. Yamanaka, M. Kondoh & T. Minamoto (2014). The release rate of environmental DNA from juvenile and adult fish. PLoS ONE 9(12): 1–13. https://doi.org/10.1371/journal.pone.0114639

Mauvisseau, Q., E. Kalogianni, B. Zimmerman, M. Bulling, R. Brys & M. Sweet (2020). eDNA-based monitoring: Advancement in management and conservation of critically endangered killifish species. Environmental DNA 2(4): 601–613. https://doi.org/10.1002/edn3.92

McKee, A.M., S.F. Spear & T.W. Pierson (2015). The effect of dilution and the use of a post-extraction nucleic acid purification column on the accuracy, precision, and inhibition of environmental DNA samples. Biological Conservation 183: 70–76. https://doi.org/10.1016/j.biocon.2014.11.031

Miralles, L., M. Parrondo, A. Hernández de Rojas, E. Garcia-Vazquez. & Y.J. Borrell (2019). Development and validation of eDNA markers for the detection of Crepidula fornicata in environmental samples. Marine Pollution Bulletin 146: 827–830. https://doi.org/10.1016/j.marpolbul.2019.07.050

Morley, S.A. & B.L. Nielsen (2016). Chloroplast DNA copy number changes during plant development in organelle DNA polymerase mutants. Frontiers in Plant Science 7: 1–10. https://doi.org/10.3389/fpls.2016.00057

Nazari-Sharabian, M., S. Ahmad & K. Moses (2018). Climate change and groundwater : a short review Engineering, Technology and Applied Science Research 8(6): 3668–3672. https://digitalscholarship.unlv.edu/fac_articles/562

Nevers, M.B., M.N. Byappanahalli, C.C. Morris, D. Shively, K. Przybyla-Kelly, A.M. Spoljaric, J. Dickey & E.F. Roseman (2018). Environmental DNA (eDNA): A tool for quantifying the abundant but elusive round goby (Neogobius melanostomus). PLoS ONE 13(1): 1–22. https://doi.org/10.1371/journal.pone.0191720

Niemiller, M.L., M.L. Porter, J. Keany, H. Gilbert, D.W. Fong, D.C. Culver, C.S. Hobson, K.D. Kendall, M.A. Davis & S.J. Taylor (2018). Evaluation of eDNA for groundwater invertebrate detection and monitoring: a case study with endangered Stygobromus (Amphipoda: Crangonyctidae). Conservation Genetics Resources 10(2): 247–257. https://doi.org/10.1007/s12686-017-0785-2

Oberemm, A., J. Becker, G.A. Codd & C. Steinberg (1999). Effects of cyanobacterial toxins and aqueous crude extracts of cyanobacteria on the development of fish and amphibians. Environmental Toxicology 14(1): 77–88. https://doi.org/10.1002/(SICI)1522-7278(199902)14:1<77::AID-TOX11>3.0.CO;2-F

Ogram, A., G.S. Sayler & T. Barkay (1987). The extraction and purification of microbial DNA from sediments. Journal of Microbiological Methods 7(2–3): 57–66. https://doi.org/10.1016/0167-7012(87)90025-X

Parsons, K.M., M. Everett, M. Dahlheim & L. Park (2018). Water, water everywhere: Environmental DNA can unlock population structure in elusive marine species. Royal Society Open Science 5(8): 180537. https://doi.org/10.1098/rsos.180537

Paul, J.H., W.H. Jeffrey & M.F. DeFlaun (1987). Dynamics of extracellular DNA in the marine environment. Applied and Environmental Microbiology 53(1): 170–179. https://doi.org/10.1128/aem.53.1.170-179.1987

Pilliod, D.S., C.S. Goldberg, M.B. Laramie & L.P. Waits (2013a). Application of Environmental DNA for Inventory and Monitoring of Aquatic Species. United States Geological Survey, USA, 4 pp. http://www.arlis.org/docs/vol1/F/835572905.pdf

Pilliod, D.S., C.S. Goldberg, R.S. Arkle & L.P. Waits (2013b). Estimating occupancy and abundance of stream amphibians using environmental DNA from filtered water samples. Canadian Journal of Fisheries and Aquatic Sciences 70(8): 1123–1130. https://doi.org/10.1139/cjfas-2013-0047

Pinto, A.J. & L. Raskin (2012). PCR biases distort bacterial and archaeal community structure in pyrosequencing datasets. PLoS ONE 7(8): e43093. https://doi.org/10.1371/journal.pone.0043093

Pukk, L., J. Kanefsky, A.L. Heathman, E.M. Weise, L.R. Nathan, S.J. Herbst, N.M. Sard, K.T. Scribner & J.D. Robinson (2021). eDNA metabarcoding in lakes to quantify influences of landscape features and human activity on aquatic invasive species prevalence and fish community diversity. Diversity and Distributions 27(10): 2016–2031. https://doi.org/10.1111/ddi.13370

Reji, L. & C.A. Francis (2020). Metagenome-assembled genomes reveal unique metabolic adaptations of a basal marine Thaumarchaeota lineage. ISME Journal 14(8): 2105–2115. https://doi.org/10.1038/s41396-020-0675-6

Renshaw, M.A., B.P. Olds, C.L. Jerde, M.M. Mcveigh & D.M. Lodge (2015). The room temperature preservation of filtered environmental DNA samples and assimilation into a phenol-chloroform-isoamyl alcohol DNA extraction. Molecular Ecology Resources 15(1): 168–176. https://doi.org/10.1111/1755-0998.12281

Sassoubre, L.M., K.M. Yamahara, L.D. Gardner, B.A. Block & A.B. Boehm (2016). Quantification of Environmental DNA (eDNA) Shedding and Decay Rates for Three Marine Fish. Environmental Science and Technology 50(19): 10456–10464. https://doi.org/10.1021/acs.est.6b03114

Schmelzle, M.C. & A.P. Kinziger (2016). Using occupancy modelling to compare environmental DNA to traditional field methods for regional-scale monitoring of an endangered aquatic species. Molecular Ecology Resources 16(4): 895–908. https://doi.org/10.1111/1755-0998.12501

Schmidt, B.R., M. Kéry, S. Ursenbacher, O.J. Hyman & J.P. Collins (2013). Site occupancy models in the analysis of environmental DNA presence/absence surveys: A case study of an emerging amphibian pathogen. Methods in Ecology and Evolution 4(7): 646–653. https://doi.org/10.1111/2041-210X.12052

Sigsgaard, E.E., I.B. Nielsen, S.S. Bach, E.D. Lorenzen, D.P. Robinson, S.W. Knudsen, M.W. Pedersen., M.Al Jaidah, L. Orlando, E. Willerslev, P.R. Møller & P.F. Thomsen (2017). Population characteristics of a large whale shark aggregation inferred from seawater environmental DNA. Nature Ecology & Evolution 1(1): 1–4. https://doi.org/10.1038/s41559-016-0004

Smith, V.H. (1998). Cultural Eutrophication of Inland, Estuarine, and Coastal Waters, pp. 7–49. In: Pace, M.L. & P.M. Groffman (eds.). Successes, Limitations, and Frontiers in Ecosystem Science. Springer, New York, 490 pp. https://doi.org/10.1007/978-1-4612-1724-4_2

Song, J. W., M.J. Small & E.A. Casman (2017). Making sense of the noise: The effect of hydrology on silver carp eDNA detection in the Chicago area waterway system. Science of the Total Environment 605: 713–720. https://doi.org/10.1016/j.scitotenv.2017.06.255

Stepien, C.A., M.R. Snyder & A.E. Elz (2019). Invasion genetics of the silver carp Hypophthalmichthys molitrix across North America: Differentiation of fronts, introgression, and eDNA metabarcode detection. PLoS One 14(3): e0203012.

Sutter, M. & A.P. Kinziger (2019). Rangewide tidewater goby occupancy survey using environmental DNA. Conservation Genetics 20(3): 597–613. https://doi.org/10.1007/s10592-019-01161-9

Tillotson, M.D., R.P. Kelly, J.J. Duda, M. Hoy, J. Kralj & T.P. Quinn (2018). Concentrations of environmental DNA (eDNA) reflect spawning salmon abundance at fine spatial and temporal scales. Biological Conservation 220: 1–11. https://doi.org/10.1016/j.biocon.2018.01.030

Petty, J.T., J.L. Hansbarger, B.M. Huntsman & P.M. Mazik (2012). Brook trout movement in response to temperature, flow, and thermal refugia within a complex Appalachian riverscape. Transactions of the American Fisheries Society 141(4): 1060–1073. https://doi.org/10.1080/00028487.2012.681102

Tran, P.Q., S.C. Bachand, P.B. McIntyre, B.M. Kraemer, Y. Vadeboncoeur, I.A. Kimirei, R. Tamatamah, K.D. McMahon & K. Anantharaman (2021). Depth-discrete metagenomics reveals the roles of microbes in biogeochemical cycling in the tropical freshwater Lake Tanganyika. ISME Journal 1971–1986. https://doi.org/10.1038/s41396-021-00898-x

Wilcox, T.M., K.S. McKelvey, M.K. Young, S.F. Jane, W.H. Lowe, A.R. Whiteley & M.K. Schwartz (2013). Robust Detection of Rare Species Using Environmental DNA: The Importance of Primer Specificity. PLoS ONE 8(3): e59520. https://doi.org/10.1371/journal.pone.0059520

Wilcox, T.M., K.S. McKelvey, M.K. Young, W.H. Lowe & M.K. Schwartz (2015). Environmental DNA particle size distribution from Brook Trout (Salvelinus fontinalis). Conservation Genetics Resources 7(3): 639–641. https://doi.org/10.1007/s12686-015-0465-z

Williams, K.E., K.P. Huyvaert & A.J. Piaggio (2016). No filters, no fridges: A method for preservation of water samples for eDNA analysis. BMC Research Notes 9(1): 1–5. https://doi.org/10.1186/s13104-016-2104-5

Xie, Y., X. Zhang, J. Yang, S. Kim, S. Hong, J.P. Giesy, U.H. Yim, W.J. Shim, H. Yu & J.S. Khim (2018). eDNA-based bioassessment of coastal sediments impacted by an oil spill. Environmental Pollution 238: 739–748. https://doi.org/10.1016/j.envpol.2018.02.081

Xu, C.L., B.H. Letcher & K.H. Nislow (2010). Size-dependent survival of brook trout Salvelinus fontinalis in summer: Effects of water temperature and stream flow. Journal of Fish Biology 76(10): 2342–2369. https://doi.org/10.1111/j.1095-8649.2010.02619.x

Yang, J. & X. Zhang (2020). eDNA metabarcoding in zooplankton improves the ecological status assessment of aquatic ecosystems. Environment International 134: 105230. https://doi.org/10.1016/j.envint.2019.105230

Yoshitake, K., T. Yoshinaga, C. Tanaka, N. Mizusawa, M. Reza, A. Tsujimoto, T. Kobayashi & S. Watabe (2019). HaCeD-Seq: a novel method for reliable and easy estimation about the fish population using haplotype count from eDNA. Marine Biotechnology 21(6): 813–820. https://doi.org/10.1007/s10126-019-09926-6