Journal of Threatened Taxa |
www.threatenedtaxa.org | 26 May 2022 | 14(5): 21102–21116
ISSN 0974-7907
(Online) | ISSN 0974-7893 (Print)
https://doi.org/10.11609/jott.7837.14.5.21102–21116
#7837 | Received 19
January 2022 | Final received 28 April 2022 | Finally accepted 05 May 2022
Environmental DNA as a tool for
biodiversity monitoring in aquatic ecosystems – a review
Manisha Ray 1 & Govindhaswamy Umapathy 2
1.2 CSIR - Centre For Cellular And
Molecular Biology, Uppal Rd, Hyderabad, Telangana 500007, India.
1 manisharay@ccmb.res.in, 2 guma@ccmb.res.in
(corresponding author)
Editor: Anonymity requested. Date of publication: 26 May 2022 (online &
print)
Citation: Ray, M. & G. Umapathy (2022). Environmental DNA as
a tool for biodiversity monitoring in aquatic ecosystems – a review. Journal of Threatened Taxa 14(5): 21102–21116. https://doi.org/10.11609/jott.7837.14.5.21102-21116
Copyright: © Ray & Umapathy 2022. Creative Commons Attribution 4.0 International
License. JoTT allows unrestricted use, reproduction,
and distribution of this article in any medium by providing adequate credit to
the author(s) and the source of publication.
Funding: Department of Biotechnology (DBT) grant no. BT/PR29032/FCB/125/4/2018
and Council of Scientific & Industrial Research (CSIR), Govt. of India.
Competing interests: The authors declare no competing interests.
Author
details: Manisha Ray has
post-graduation in Molecular Microbiology and is currently a PhD student at CSIR-CCMB,
Hyderabad. Her research interest lies in studying microbial ecology and the
novel functions of microbes that help ecosystems to thrive and support other
life forms. Her doctoral work aims at using eDNA as a tool to decipher the
species and genomic diversity of Phylum Cyanobacteria in relation to ecosystem
services and changing physico-chemical factors of Chilika Lake, Odisha. Govindhaswamy
Umapathy is a Conservation Biologist. He works on understanding species
extinction in human dominated landscapes and develops various biotechnological
tools in biodiversity conversation at Laboratory for the Conservation of
Endangered Species, CSIR-CCMB, Hyderabad.
Author
contributions: MR and GU
conceptualized the content of the paper. MR collected all relevant references
and wrote the manuscript. Both MR and GU revalidated the content and proofread
the manuscript.
Acknowledgements: We are thankful to S. Manu and
Gopi Krishnan for their constant suggestions to improve the manuscript.
Abstract: The monitoring of changes in
aquatic ecosystems due to anthropogenic activities is of utmost importance to
ensure the health of aquatic biodiversity. Eutrophication in water bodies due
to anthropogenic disturbances serves as one of the major sources of nutrient
efflux and consequently changes the biological productivity and community
structure of these ecosystems. Habitat destruction and overexploitation of
natural resources are other sources that impact the equilibrium of aquatic
systems. Environmental DNA (eDNA) is a tool that can help to assess and monitor
aquatic biodiversity. There has been a considerable outpour of research in this
area in the recent past, particularly concerning conservation and biodiversity
management. This review focuses on the application of eDNA for the detection
and relative quantification of threatened, endangered, invasive and elusive
species. We give a special emphasis on how this technique developed in the past
few years to become a tool for understanding the impact of spatial-temporal
changes on ecosystems. Incorporating eDNA based biomonitoring with advances in
sequencing technologies and computational abilities had an immense role in the
development of different avenues of application of this tool.
Keywords: eDNA, non-invasive,
biomonitoring, endangered, eutrophication, anthropogenic
Introduction
Earth is an abode of numerous
living organisms which exist in varying environmental conditions and all are
ultimately interconnected. Major unknowns in estimating global biodiversity
are: how many species inhabit Earth, and what is their rate of extinction. Only
a fraction of total biodiversity is known, and a substantial number of species
that have not yet been accounted for and are vanishing without our knowledge.
Since all species are dependent on each other in some way or another, the
removal of one drastically affects other species. Unravelling each point in
this network of life is important to study how an ecosystem at large functions
and also to understand the life history of a species and how new communities
get established.
Aquatic ecosystems comprising
freshwater, brackish, and marine water in nature are the sources of a lot of
species diversity ranging from microbes to mammals. The impact of human
activities on these life forms is multifactorial. An increase in the emission
of carbon from anthropogenic actions is leading to an increase in water
temperature, acidification and oxygen deprivation of aquatic systems (Jiao et al. 2015). The changes
in the abiotic parameters of the ecosystem is accompanied with impacting the
cycling and efflux of nutrients. These changes in turn regulates the geographic
distribution of the life forms in that
habitat (Nazari-Sharabian et al. 2018).
According to the special report of IPCC
(The Intergovernmental Panel on Climate Change) on changing ocean and
cryosphere 2019, by the year 2100, the ocean will witness an increase in
temperature by 2 to 4 times and oxygen levels will decline further resulting in
increase in the volume of oxygen-deficient zones (OMZ). These changes will
impact ecosystem services with a projected decrease in fish catch potential and
global marine biomass, which will further impact revenue generation, food
security and threaten livelihood. Analysing the world’s biodiversity becomes a
critical aspect of learning about the distribution of these “biodiversity
hotspots” and applying conservation practices to protect these areas.
The traditional practices of
estimating biodiversity are biased towards the sampling of particular species
(Gunzburger 2007) or can also pose a risk to sensitive organisms. In recent
times, molecular techniques are gaining importance in the estimation of
biodiversity and its conservation in the world. One such molecular tool is the
study of environmental DNA (eDNA), which has tremendous potential to develop
our understanding of biodiversity science and provide implications for
conservation practices with census data of species present at a comprehensive
scale in real-time.
What is environmental DNA?
The term ‘environmental DNA’
(eDNA) was introduced in the field of microbiology for the detection of
microbial communities in sediments by Ogram et al. (1987). eDNA has been classified based on particulate
size: aggregates of eDNA greater than 0.2 µm were termed as particulate DNA
(P-DNA) while eDNA less than 0.2 µm is termed as dissolved DNA (D-DNA) by (Paul
et al. 1987). DNA extracted non-invasively from environmental sources like
soil, air, or water is termed environmental DNA (eDNA). It has a polydisperse
nature, i.e., the origin of eDNA can have several sources like sloughed cells,
faecal matter, spores, slimy coating (in amphibians), or dead carcasses. Based
on the source of origin of eDNA, it undergoes selective decay and thus
complicates the evaluation of decay rates (Wilcox et al. 2015). eDNA has been
used in the aquatic system to either detect the presence or absence of a
species or for quantitative estimation of a particular species. Its application
varies between lotic and lentic ecosystems as their nature varies. The lotic
ecosystem is flowing and can transport eDNA directionally downstream from the
correct location of the target organism, whereas the lentic ecosystem is
stagnant. eDNA is released into the environment and subsequently undergoes progressive
decay due to many biotic and abiotic factors.
Factors governing the
concentration of EDNA in the aquatic environment:
Based on the literature review,
it has been perceived that there can be numerous factors that can govern the
concentration of eDNA at a particular time and space, but can be primarily
divided into three categories:
eDNA released by the organism
Persistence of eDNA in different
environmental conditions
Capture protocols for eDNA and
sensitivity of detection assay
eDNA release by the organism
The concentration of eDNA
released by an organism and the degradation rate of DNA in a particular
environment are the two attributes on which the concentration of eDNA varies on
a given spatial-temporal scale. The release of eDNA is a complex interaction
between environmental conditions, the natural history of an organism, its
metabolic rate, and the developmental stage. With an increase in the
temperature of the water, the mobility of fish has been reported to increase (Petty et al. 2012) hence the metabolic rate also increases (Xu
et al. 2010) until a physiological limit of tolerance is attained. The timing
of sample collection plays a vital role because it can help in capturing the
presence of the migratory species based on its natural history or seasonal
variability in levels of resident species (Lesley et al. 2016). It has been
found that with different developmental stages, eDNA released also varied. eDNA
release rate per fish body weight is slightly more in the juvenile group when
compared to that of an adult group due to factors related to ontogeny. But, the
rate of eDNA release per individual is more from adult fish than juveniles
because of the larger body size of adult fish (Maruyama et al. 2014). Hence, it
is difficult to infer if the source of eDNA is from a higher number of
juveniles or a lesser number of adults.
Persistence of eDNA in different
environmental conditions
DNA has limited chemical
stability (Lindahl 1993) and once it is shed into the environment, it can
either persist in free form or get adsorbed to organic or inorganic matter or
else get sedimented or degraded (Dejean et al. 2011). The persistence of eDNA
depends on factors which are divided into three categories - abiotic
(temperature, salinity, pH, oxygen, & light), biotic (extracellular enzyme
& microbial community), and DNA characteristics (length, conformation,
& membrane-bound) reviewed by Barnes et al. (2014).
Capture protocols for eDNA and
sensitivity of the assay
Most efficient capture protocols
are a combination of a selection of the most appropriate filter materials which
allows filtering the maximum amount of water using powerful automatic motors
along with optimized isolation protocols and preservation techniques to
maximize the yield of eDNA. The pore size of the filter is also an important
feature that decides which source of DNA shall be enriched- gametes, sloughed
cells free DNA, etc, and also the target group of organisms. If microorganisms
are the target, then very low pore size filters will capture most of them. Renshaw et al. 2015 found that there was no significant
difference in copy number in the case of 0.8 µm cellulose nitrate (CN) filter
or 0.8 µm polyether sulphone (PES) filters. In contrast to this, (Hinlo et al.
2017) and (Liang & Keeley 2013) found a CN filter to have a significant
difference in DNA yield. This difference could be due to a different
combination of isolation and preservation protocol.
Precipitation and filtration are
the two methods that have been used to extract eDNA from water samples.
Precipitation is generally used for smaller volumes by using salt and ethanol
to precipitate extracellular DNA by using centrifugal forces (Maniatis et al.
1982). Filtration is more size-dependent and is based on the property of filter
material to keep eDNA. Filtration had shown more yield of eDNA in combination
with isolation protocols for DNA (Deiner et al. 2015). DNA isolation: three
protocols generally have been used to extract DNA from filters, namely the
phenol chloroform Isoamyl alcohol method (PCI), Qiagen’s DNeasy® blood and
tissue kit, and MoBio’sPowerwater® DNA isolation kit. PCI method has been shown
to yield more targeted DNA compared to Qiagen’s DNeasy® blood and tissue kit
using a 0.45 µm CN filter. While
MoBio’sPowerWater® DNA isolation kit has shown more yield than the PCI method
using a 1.5 µm glass membrane filter (GMF) (Renshaw et al. 2015). However,
filtration along with Qiagen’s DNeasy ® blood and tissue kit has shown a higher
diversity of eukaryotes being detected compared to that of limited species
being detected in the case of the PCI method with filtration (Deiner et al.
2015). We believe that skipping the use of lysis buffer during isolation of
eDNA from filter membranes will help in reduction of the microbial eDNA part as
it will limit the lysis of microbial cell. This method will help in studying
the non-microbial or eukaryotic taxa. The flow rate through filters had also
been seen as a crucial step, as eDNA might start the process of degradation if
the filtration time is too much. Hence, filters with higher flow rates have
been preferred (Hinlo et al. 2017).
Preservation of DNA and storage
is also a very crucial step in the case of detection of very low abundant
species or quantification of the abundance of any species, as even a slight
degradation in copy numbers might give faulty results. Freezing of filters at a
very low temperature cannot always be workable in field conditions hence 95%
ethanol (Minamoto et al. 2015), Longmire buffer (Renshaw et al. 2015; Williams
et al. 2016), and CTAB (Renshaw et al. 2015) has been shown as alternatives. It
was found that both the Longmire buffer and CTAB preserved filtered eDNA for
over two weeks at 20˚C but at 45˚C Longmire, buffer outperformed CTAB buffer
(Renshaw et al. 2015). Enhanced CTAB buffer has shown to have better inhibitor
removal activity while Longmire buffer has the property to preserve eDNA for a
longer time (Hunter et al. 2019). It is recommended to choose the best
preservation buffer according to one’s requirement by conducting a pilot
experiment.
PCR inhibitors can be responsible
for incorrect estimation of abundance or failure in the detection of very low
copy number species. These inhibitors can either be co-extracted along with the
extraction of eDNA or during isolation protocols. These inhibitors, like phenol
and proteinase K, are removed by adding BSA to the PCR master mix (Deiner et
al. 2015). These inhibitors might also be removed using inhibitor removal
columns available in some commercial kits (McKee et al. 2015).
The specificity of primer and
sensitivity of PCR is crucial. Nested PCR has been shown to improve detection
compared with conventional PCR (Jackson et al. 2017). Detection rates of eDNA
are greater with digital droplet PCR
(ddPCR) than real-time PCR (qPCR) at lower concentrations (Doi et al. 2015).
Quantitative estimation of biomass was shown to be more accurate by using ddPCR
than qPCR. ddPCR was suitable for measurement of the natural sample as
inhibitory substances have little effect on DNA quantification, as endpoint PCR
amplification in each droplet can be detected independent of amplification
efficiency in ddPCR (Doi et al. 2015). There have been reports that base pair
mismatches in the primer have more impact than that of the probe and the
location of the mismatch also plays an important role. Base pair mismatch near
the 3’ end has shown a larger impact on specificity than in the 5’ end or any
other region (Wilcox et al. 2013).
Applications of eDNA
as a tool in conservation and biodiversity monitoring
From deciphering single species
to documenting entire communities, our understanding of eDNA study has
progressed over the years. There is a multitude of applications of eDNA ranging
from detection of invasive species, elusive species or any other ecologically
important or threatened species to unravelling community dynamics and their
response to changing spatial-temporal changes. This has paved new avenues in
ecosystem management. In the case of microbes, less than two per cent of the
total are culturable (Wade 2002). This necessitates the implementation of
culture-independent methods for understanding their genomic and functional
aspects . The eDNA technique has found a host of new applications over several
years in the field of ecosystem monitoring and management.
Detection of species
Its advent revolved around the
uncovering of single species like the detection of invasive species, Crayfish Procambarus
clarkia (Geerts et
al. 2018), endangered or vulnerable species, Wood Turtle Glyptemys insculpta
(Lacoursière-Roussel et al. 2016c), or some elusive species, Oriental Weather
Loach Misgurnus anguillicaudatus (Hinlo et al. 2017). A brief
methodology for the detection of species from environmental aquatic samples
using the eDNA method has been depicted in Image 1. eDNA technology along with
occupancy modelling has been utilised for monitoring the presence of endangered
species of Northern Tidewater Goby species Eucyclogobius newberryi and
Southern Tidewater Goby species Eucyclogobius kristinae across the
entire coast of 1,350 km (Sutter & Kinziger 2019). They found that eDNA
technology showed double the rate of detection compared to the seining method,
which resulted in improved site occupancy estimates as Northern Tidewater Goby
was detected at two sites where their presence was never known before. A
positive correlation was observed between eDNA concentration and catch per unit
effort (CPUE). The implication of such objectives paves the path towards
improved conservation goals. A list of key studies, along with the primers used
in the detection and monitoring of different species, is summarised in Table 2.
2) Population genetics studies
Population genetics has been a
significant aspect in the study of ecology as it gives information about
evolutionary history. But, research in this sector with the use of eDNA has
just begun and is in its initial stage. Sampling in the case of population
genetics has been a major challenge, especially in threatened organisms. eDNA
approach helps to mitigate such challenges and helps in the study of organisms
that are difficult to sample.
Researchers have used eDNA that
was extracted from sea water to examine
the haplotype frequencies and genetic diversity at population level in Whale Shark
Rhincodon typus (Sigsgaard et al. 2017). They used high throughput
sequencing of two mitochondrial control region sequences and compared it with
tissue samples from 61 individuals at the same locality from when samples for
eDNA were collected. It was found that relative frequencies in both were
similar. The more current study of elusive Harbour Porpoise Phocoena
phocoena used high throughput sequencing for studying haplotype diversity
and found eight unique mitochondrial DNA sequences from seawater sampling
(Parsons et al. 2018). In another study, species and ecotypes of Killer Whales
(Orcinus orca were identified following encounters using digital droplet
PCR and subsequently were sequenced. It was identified that the killer whale
encounter was from a southern resident community (Baker et al. 2018). In a more recent study by Stepien et al.
(2019), Silver Carp Hypophthalmichthys molitrix which is an invasive
species in the U.S was studied for its introduction and spread using eDNA and
mitochondrial markers targeting cytochrome b and c oxidase and nuclear DNA
microsatellite markers.
3) Estimation of relative abundance
The scope of eDNA is more than
just detecting the presence/absence of an organism. Estimation of copy number
or biomass has been the major focus and extrapolation of avenues in which an
eDNA study can be helpful. The information about an organism’s relative
abundance in the spatial-temporal scale helps to document the seasonal
variations due to its response to the environment or due to other external
forces like inter or intra-species competition. Estimation of abundance can
have economic value in aquaculture if yield in a particular season can be known
beforehand by studying the history of a few years about its seasonal
variations. Even though numerous factors play a role in the persistence of eDNA
in the environment along with its polydisperse nature, as discussed in the
earlier section, if all protocols related to filtrations, isolation, and
preservation are followed the same way for all samples across all seasons, then
it can give an insight of its relative abundance. eDNA concentration of Lake
Trout Salvelinus namaycush was estimated in 12 natural lakes and its
abundance was compared to that of standardized gill net catches (catch per unit
effort -CPUE and Biomass per unit effort- BPUE (Lacoursière-Roussel et al.
2016a) . Another study showed that the eDNA released from the target organism
is a measure of its biomass for which laboratory and field-based experiments
were conducted on Common Carp. This highlighted that the concentration of eDNA
positively correlated to its biomass and can serve to understand its
distribution in natural systems (Takahara et al. 2013).
An endangered amphidromous fish,
Ryukyu ayu Plecoglossus altivelis ryukyuensis, was monitored to estimate
abundance using qPCR with specific primers to amplify the mtDNA ND4 region. The
visual snorkelling surveys by individually fish counting positively correlated
to eDNA copies/ml (Akamatsu et al. 2020). In another recent study by (Capo et
al. 2019), digital droplet PCR was used to detect as well as quantify Brown
Trout Salmo trutta and Arctic Char Salvelinus alpinus
populations. While they compared between fish population estimated by conventional
Catch per unit effort (CPUE) from gill netting method and eDNA concentration
from digital droplet PCR, no significant correlation could be deduced, yet this
paves a promising path for future research in this aspect by focussing on
challenges and limitations which need to be overcome. This study also focuses
on probable problems of stand-alone methods and how a congregation of various
approaches, together with optimised protocols, can yield the desired result. In
another method of individual estimation in a population, a novel NGS based
strategy was used which counted haplotypes in the mitochondrial D-loop sequence
of eel. This method was named HaCeD-Seq and it was claimed to be better and
more accurate in quantification than conventional qPCR. However, its accuracy
decreased when the number of individuals increased because of lesser unique
haplotypes and more overlap of sequence among individuals (Yoshitake et al.
2019). A much deeper understanding of factors affecting the abundance of eDNA
copies in natural environments can help to boost this technology and can be of
extreme importance, especially in fisheries management and has direct
implications on increasing its economic value.
Though there are substantial
volumes of research in this field of eDNA our understanding is still limited.
There have been enormous volumes of reports concerning the release and
persistence of eDNA in various environments, but there has been no noticeable
research on the effect of stressed environments like human activities or
predation pressure on the release rate of eDNA and how it brings changes in our
overall understanding of species abundance.
4) Studying the communities in
the ecosystem:
Holistic study of ecosystem and
metabarcoding gives more inferential insights and hence an upheaval in the use
of eDNA has led to transitioning from DNA barcoding to metabarcoding, hence
from studying single species to communities and their interactions. This in
turn has enabled extracting more information and data using less time and
manpower under field conditions.
Understanding ecosystem health in
aquatic bodies
In the last few years, a new
paradigm has got an increasing focus that aids in the understanding of the
health of ecosystems using metabarcoding. This can be accomplished by
establishing the link between changing abiotic factors and the ecology of the
ecosystem to that of changing biotic interactions among communities inferred
from metabarcoding data. Eutrophication is a process of enrichment of nutrients
like nitrogen and phosphorus (Conley et al. 2009) in water bodies. Although natural eutrophication
occurs at a very slow pace due to the ageing of water bodies (Carpenter 1981),
in the past century cultural eutrophication due to anthropogenic actions has
led to rapid nutrient efflux into the water bodies (Smith 1998). Eutrophication
is one of the major indicators of anthropogenic means of changing the
physicochemical parameters of aquatic bodies along with the construction of
dams, channelisation and sediment transport as depicted in Image. 2 (Bianchi
& Morrison 2018). This can change the biological productivity and community
structure composition of the water bodies (Sawyer 1966). There are manifold
effects of eutrophication, algal blooms being the most noticeable of them. The
change in Nitrogen (N): Phosphorus (P) ratio or dissolved organic carbon (DOC):
dissolved organic nitrogen (DON) has been found as a variable in case of such
blooms (Anderson et al. 2002). The major component of these blooms is
Cyanobacteria and they produce cyanotoxins which act as neurotoxins and
hepatotoxins for fishes, mammals and also humans (Oberemm et al. 1999;
Carmichael 2001). Literature search shows that though there are some studies in
this area using metabarcoding to find the community structure of bacteria and
planktons (Wan et al. 2017; Banerji et al. 2018) in aquatic systems, we find
very few studies relating how anthropogenic disturbances might affect the
ecosystem services.
One such study by (Craine et al.
2017), showed the relation among the changing environmental variables like
dissolved nutrient concentration with four taxonomic groups namely bacteria,
phytoplankton, invertebrates, and vertebrates. Further, they found that
increasing eutrophication of nutrients and river size were the crucial
variables that changed the abundances of these broad taxa. Clark et al. (2020)
demonstrated the impact of enrichment with fertilizers on the benthic
communities in two estuaries that differed in its environmental attributes. The effect was studied using eDNA
metabarcoding on bacterial (16sRNA), eukaryotic (18sRNA) and diatom only (rbcL)
communities after seven months of nutrient enrichment. They found that there
were clear changes in the case of bacterial and eukaryotic taxa but more
obscure in the case of diatoms. Also, they found that these changes could be
observed within 150 g N m-2 of fertiliser treatment, suggesting that early
signs of ecosystem degradation could be studied and the restoration process
could be initiated using such shifts in the structure of communities as cues.
Such methods were used initially for species detection and quantification, now it has been used for ecosystem assessment
and monitoring for its health. The focus on studying community structure as a
measure of predicting ecosystem health has advantages as it brings about a
holistic view of the same and helps acknowledge the fact how species
interdependency is linked to abiotic factors as well. One such study in this
regard was by Yang & Zhang (2020), where they used zooplankton community to
assess the quality of the ecosystem. They showed across three seasons, i.e.,
dry, normal and wet, the species detected remained the same but their relative
abundances changed at the temporal scale. The study also emphasised that though
eDNA based abundance studies are the semi-quantitative presence of species
along with changing relative abundances of indicator zooplankton species at
spatial-temporal scale. The water quality index correlated with 60 different
zooplankton indices which were both qualitative and quantitative. But such
correlations need not always be direct/correct due to other confounding factors
like interaction with other species communities, which in turn influence the
zooplankton community. Such studies aren’t limited to only aquatic systems but
also have seen recent applications in analysing sediment pollution from coastal
regions at a spatiotemporal scale. In a study by Lee et al. (2020), the changes
in microbial diversity at phylum level showed variation concerning 13
environmental variables of sediment pollution and toxicity. Although certain
phyla remained dominant others showed shifts in community structure.
Whole-genome or
metagenome-assembled-genomes (MAGs) based studies
Most of the above-mentioned
studies are based on the amplification of the universal marker regions of DNA
or amplicon-based 16sRNA sequencing and can have bias during PCR (Jovel et al. 2016). They are
based on the single-gene approach of identification of its taxa. One way to
solve this is to bring in a multi-gene or whole genome-based taxonomic
approach. This also helps in functional prediction of genes like those involved
in the biogeochemical cycling by microorganisms
and can be of great significance in studying ecosystem services. Another
method used in recent times to study taxonomy based on phylogenetic
reconstruction is by assembling the metagenomes also called
metagenome-assembled genomes (MAGs) and is of immense importance in
culture-independent microbial molecular studies. In a study by Tran et al.
(2021), the role of specific taxa of microbes in biogeochemical processes in
the lake, they had assembled 24 samples individually by de novo method and
generated 24 MAGs which were then binned, then finally used for the
construction of concatenated gene phylogeny using single-copy ribosomal
proteins. They found that MAGs showed an
abundant genomic capacity for nitrogen and sulphur cycling. In another similar
work by Reji & Francis (2020), MAGs were constructed for a lineage of
Thaumarchaeota, a phylum of Archaea from the marine ecosystem. This lineage
seemed to be devoid of genomic repertoire only for chemoautotrophy as it did
not have ammonia-oxidising machinery and other pathways related to the same as
in other archaeal lineages. This highlights the metabolic diversity among the
microbial communities for nutrient acquisition and processing, which is
generally not possible in the case of culture-dependent molecular studies as
most of the bacteria are non-culturable.
We find studies in eDNA are
becoming broader in perspective rather than only species detection, but this
holds much more potential in coming years in terms of answering some basic
ecological questions about the effect of anthropogenic disturbances that lead
to changes in abiotic factors of an ecosystem which changes community structure
composition at spatial and temporal scales and threatens ecosystem services and
ecosystem health.
Also, there has been very little
emphasis on understanding the functional role of eDNA studies i.e., how it can
be used to compare eDNA and eRNA and decipher the active constituent of the
genome which might have an important role in ecological functioning like genes
responsible for biogeochemical cycling of various nutrients in nature. Since
RNA has lesser stability than DNA, it is a better and more reliable measure for
studying the presence of an organism or its abundance and hence has been used
in forensic science to estimate the time since deposition of biological
material (Bremmer et al. 2012).
Technical Challenges
of eDNA-based methods
Although eDNA technology has
provided a plethora of its applications and helped to understand nature in a
holistic view, it still suffers from a few challenges which require more
refinement and troubleshooting.
PCR Bias
The foremost problem arises in
the estimation of relative abundance using a metabarcoding approach where PCR
bias serves as a major issue. Those taxa having organisms that are not affected
by seasonal variations and are more abundant in number having high dispersal
ability tend to be over-represented during sampling than sedentary and seasonal
ones. Even the copy number of target loci may vary among taxa, individuals, or
tissue types. There can be several possibilities that can cause bias in PCR
amplification during metabarcoding. PCR is a stochastic process hence can
become a source of bias like the number of PCR cycles, mismatch in primer
binding site, annealing temperature, secondary structures in template DNA,
multiple templates in the sample, more selectivity of primers for some specific
taxa and copy number of target loci (Pinto & Raskin 2012; Elbrecht & Leese 2015;
Fonseca 2018). Nichols et al. (2018), showed that polymerase can show bias
toward GC sequence and can alter the relative abundance of molecules
dramatically during metabarcoding and that this bias can be removed
experimentally using a molecular identifier (MID) where starting material is
disambiguated bioinformatically following PCR.
Unknown source of eDNA
There have been reports of
transport of undigested material of higher organisms or their dead carcasses,
which gives a false implication of their presence at that particular site (Song
et al. 2017).
Problems with single-species
detection and bias in eDNA extraction protocols
Single species detection in the
marine environment is challenging due to increased dilution, higher salinity,
and more intermixing of constituents (Cristescu & Hebert 2018). Higher salt
concentration can also inhibit PCR and give false implications about the
absence of the target organism. Continuous sample collection either monthly or
seasonal depending on the research question might serve as a way to overcome
false detections. Enrichment of extracellular DNA can help in reducing the signal
from non-target microbial cells as they are more abundant in natural
ecosystems.
Chances of false positives and
false negatives
False positives errors (Type-I)
arise when there is no actual presence of the target organism, but still, it is
detected at that site which can be due to contamination issues or problems in
PCR optimization or sequencing (Schmidt et al. 2013). The specificity of
primers also plays a vital role in minimizing picking up related species having
very little sequence variance than the target species. False-negative errors
(Type-II) arise when a target organism fails to get detected even though it is
present there. This can be attributed to reasons like inefficient sample
preservation, faulty sampling practices, or less sensitivity of detection assay
in the case of low-abundant organisms.
Measuring the absolute abundance
of the species is practically not possible
Factors governing the
quantification of eDNA are dependent on countless factors. Many juvenile
organisms or a lesser number of adult organisms, might release an equal amount
of eDNA. Hence, biomass estimation can be made but estimating abundance can be
difficult with PCR-based methods (Elbrecht & Leese 2015). Change in eDNA
concentration due to seasonal variation has been reported by many, which can
lead to difficulty in estimation of true abundance (Barnes et al. 2014).
Maintaining many replicates for PCR and DNA isolation can increase the
probability of capturing many taxa by the metabarcoding approach (Leray &
Knowlton 2017).
eDNA shedding and decay rates in
a particular environment govern the quantification of particular species. In a
study by Sassoubre et al. (2016), eDNA decay and shedding rates in seawater
mesocosm were assessed for three economically and ecologically important marine
fishes- Engraulis mordax (Northern Anchovy), Sardinops sagax
(Pacific Sardine), and Scomber japonicas (Pacific Chub Mackerel) by
Taqman® qPCR assay. In another similar study, Round Goby Neogobiusme
lanostomus, an elusive species, was assessed for the shedding and decay
rate of eDNA. eDNA shedding was measured after fixed time intervals, and the
effect of temperature on shedding rate was also studied. First order decay
constants were calculated and the decay rate was found to be slightly lower in
cold water than in warm water. A most significant part of the study was that a
positive correlation between eDNA concentration and the number of round gobies
collected using two capture methods could be established (Nevers et al. 2018).
Knowledge about these factors together with factors affecting abundance can act
as a lead in abundance estimation studies. The effect of various environmental
factors affecting the persistence of eDNA and indirectly the abundance has been
shown by (Barnes et al.2014).
Potential solutions
to the challenges:
We have developed a few
reflections that might be helpful for future eDNA research:
PCR- free methods
As mentioned in the previous
section, PCR introduces several kinds of biases. Hence developing a new
methodology to overcome this step during the metabarcoding approaches can be of
immense value in future. Following the same optimized capture and isolation
protocols for all collected samples along with maintaining appropriate
controls, increasing the number of replicates at each site of sample
collection, seasonal collection of samples at the same points throughout the
year and developing of PCR-free approach can help to give a picture of
near-absolute abundance of organisms. Manu & Umapathy (2021), designed a novel
metagenomic workflow which used PCR-free library preparation during
Next-generation sequencing (NGS) and performed an ultra-deep sequencing and
pseudo taxonomic assignment to get the biodiversity of an ecosystem across the
entire tree of life.
Source of eDNA can be both from
live and dead organisms: In aquatic systems, transport of eDNA has been
observed for tens of kilometres (Andruszkiewicz et al. 2019), hence mere
detection of eDNA at a particular time neither confirms the exact location nor
the source since eDNA can persist in systems for approximately 48 hours
(Collins et al. 2018). A probable way of accounting for this issue is by an
increase in both the number of biological and technical replicates as well as
sampling continuously for a minimum of three days at the same locations which
might add more confidence to the data acquired.
Sampling criteria, filtration of
samples and isolation of eDNA protocols
It should be based on the
research question. The standardisations of all the protocols should consider
the main hypothesis of the research. For example, if the purpose of the
research question is only addressed towards deciphering prokaryotic diversity,
then all the protocols should be tweaked to get enriched eDNA from that
community and also to get maximum diversity of that taxa. This might help to
get a better and more focused results. The enrichment of extracellular DNA
should be targeted if the question needs studying the entire biodiversity of
the system.
Reducing false positives and
false negatives
It has been reported that
increasing the number of replicates during PCR can minimize the chances of
false negatives. The inclusion of positive control during PCR can help check
the optimization of PCR conditions. To limit the detection of false absence,
the number of replicates should be a minimum of six for a detection probability
of 0.5, and for even lower detection probability, a minimum of eight replicates
are needed (Ficetola et al. 2015). When both detection probability and the
number of replicates has been too low, it was found that this underestimated
occupancy and overestimated the detection rate (Ficetola et al. 2015).
Only relative abundance can be
quantified
Since eDNA yield depends on the
developmental stage and size of an individual (Petty et al. 2012), mesocosm or
aquarium-based studies can be standardised for a particular developmental stage
or size of an individual of a species to get an estimate of the actual number
of individuals, but mimicking natural environmental conditions of an ecosystem
is very difficult and prone to errors. Also, since every ecosystem has its own
abiotic and biotic features, the results might not be reproducible.
Conclusion
The use of eDNA and its multitude
of applications has become a fast-developing area. This outpour comes in the
light of the increasing need to monitor changes in our environment and how
living organisms are affected by them. This helps to have better conservation
focus on regions or species of special importance. In this era of unprecedented
climate change and the concerns possessed by it, eDNA can help assist in the
monitoring of biodiversity alongside other conventional methods to yield better
results. Any new technology calls for new challenges and room for improvement,
so is with eDNA where chances of contamination and bias for the detection of
abundant species are higher. But with more stringent methodology and
computational advancements, the risks are getting minimised. It has the potential
to answer many deeper questions of research in this area.
Table 1. Few key studies on the
applications of eDNA as a tool.
|
|
Study details |
References |
|
Detection of species: |
||
|
1) |
Detection of alien invasive
species Procambarus clarkii (crayfish) in water from the natural pond
and artificial aquarium |
(Geerts et al. 2018) |
|
2) |
Detection of a threatened
species Glyptemys insculpta (wood turtle) using qPCR by designing
species-specific primers and Taq man probe |
(Lacoursière-Roussel et al. 2016c) |
|
3) |
Detection of endangered Shasta
crayfish (Pacifastacus fortis) and invasive crayfish (Pacifastacus
leniusculus) in river water |
(Cowart et al. 2018) |
|
4) |
Comparing the sensitivity of
detection of alien invasive species- American bullfrog (Lithobates
catesbeianus) |
(Dejean et al. 2012) |
|
5) |
Detection of invasive species,
African jewelfish (Hemichromis letourneuxi) and determine the lower
limit of detection and effect of fish density and time on detection in an
artificial aquarium |
(Díaz-Ferguson et al. 2014) |
|
6) |
Detection of invasive species,
New Zealand mud snails (Potamopyrgus antipodarum) and to find the time
till which eDNA remains detectable in the aquatic system |
(Pilliod et al. 2013a) |
|
7) |
Detection of invasive submerged
aquatic plant, Egeria densa in pond water |
(Fujiwara et al. 2016) |
|
8) |
Differentiating between endemic
species, Japanese giant salamander (Andrias japonicum) and exotic
species, Chinese giant salamander (Andrias davidianus) using eDNA |
(Fukumoto et al. 2015) |
|
9) |
eDNA detection rate has a
positive relationship with flow volume in waterways and has a more pronounced
effect on eDNA detection probability than other co-variates like temperature,
dissolved oxygen concentration, pH |
(Song et al. 2017) |
|
10) |
Detection of transient pelagic
marine fish, Chilean devil ray (Mobula tarapacana) |
(Gargan et al. 2017) |
|
Estimation of biomass/abundance: |
||
|
1) |
Effect of water temperature and
eDNA capture method on altering the relationship between eDNA concentration
and fish biomass of economically important salmonid, Brook Charr (Salvelinus
fontinalis) |
(Lacoursière-Roussel et al.
2016b) |
|
2) |
Killer whale (Orcinus orca)
eDNA quantification using ddPCR from seawater |
(Baker et al. 2018) |
|
3) |
Estimation of transport distance
of eDNA of brown trout (Salmo trutta, L.) using a dual-labelled probe
for relative quantification |
(Deutschmann et al. 2019) |
|
4) |
Comparison of detection
probability, density, biomass and occupancy with traditional methods of
sampling of Rocky Mountain tailed frog (Ascaphus montanus) and Idaho
giant salamander (Dicamptodon aterrimus) |
(Pilliod et al. 2013b) |
|
5) |
Salmon DNA was measured from
water samples during the spawning season using species-specific quantitative PCR
probes and factors affecting the correlation between eDNA concentration and
biomass of these fishes were also studied. |
(Tillotson et al. 2018) |
|
Studying the communities in the ecosystem |
||
|
1) |
The direct impact of an
anthropogenic activity like an oil spill on the coastal marine ecosystem was
observed. The succession of communities after the event was monitored which
included bacteria, metazoans and protists. Certain communities were found to
be resistant to the effect of this incidence whereas few others were
conferred with the sensitivity to this. |
(Xie et al. 2018) |
|
2) |
The community-level response in
cyanobacteria, diatoms and microbial eukaryotes were correlated to
physicochemical parameters of Lake Constance like rising phosphorus and air temperature.
Major environmental perturbations like eutrophication during the 20th century
were found to align with the reversion of resilience demonstrated by the
communities. |
(Elberri et al. 2020) |
|
3) |
The change in community
structure of bacterial, protistan, and metazoan communities in response to
pollution status of the river using eDNA metabarcoding. The varying level of
nutrients in the ecosystem was shown to be the main driving factor in the
relative abundance of OTUs and community structure. |
(Li et al. 2018) |
|
4) |
The spatial distribution of
bacterial communities was studied using metabarcoding. The change in the
richness of these communities and the abundance was shown to be a measure of
the degree of anthropogenic contamination and can be an area to focus on for
biomonitoring of coastal ecosystems. |
(Garlapati et al. 2021) |
|
5) |
The study focuses on
identifying the association between the fish assemblages in the ecosystem and
invasive species and how these get affected by environmental co-variates and
human-induced disturbance. |
(Pukk et al. 2021) |
Table 2. Key studies for
detection of important species in aquatic ecosystem.
|
|
Aim of Study |
Primer sequence used in the
study |
Reference |
|||||||||||
|
1. |
Detection of invasive rusty
crayfish (Orconectes rusticus) in inland lakes using specific qPCR
primers targeting the cytochrome c oxidase subunit 1 (COI) sequences |
Forward primer |
Reverse primer |
Amplicon length (in bp) |
(Dougherty et al. 2016) |
|||||||||
|
5′-CAGGGGCGTCAGTAGATTTAGGTAT-3′ |
5′-CATTCGATCTATAGTCATTCCCGTAG-3′ |
128 |
||||||||||||
|
2. |
Detection of invasive common
Atlantic slipper limpet (Crepidula fornicate) from environmental
seawater sample using species-specific primers targeting COI gene |
Forward primers |
Reverse primers |
Amplicon length (in bp) |
(Miralles et al. 2019) |
|||||||||
|
5′-GATGATCAACTATACAATGTA-3′ |
5′- TAAACCGTTCAACCGG-3′ |
239 |
||||||||||||
|
3. |
Detection of invasive signal
crayfish (Pacifastacus Leniusculus) in river and lake
water samples using Taqman probe and species-specific primers targeting the
COI gene |
Forward primer |
Reverse primer |
Probe |
Amplicon length (in bp) |
(Harper et al. 2018) |
||||||||
|
5´-ATAGTTGAA AGAGGAGTGGGTACT-3´ |
(5´-TAA ATCAACAGAAGCCCCTGCA-3´) |
FAM-5´-CCTC CTCTAGCAGCGGCTATTGCTCATGC-3´-BHQ1 |
87 |
|||||||||||
|
4. |
Studying the distribution of
silver carp (Hypophthalmichthys molitrix) and developing of novel
methodology for on-site detection of the species |
Forward primer |
Reverse primer |
Probe |
(Doi et al. 2021) |
|||||||||
|
5′-GCAATTAACTTCATCACCACAACTATTA-3′ |
5′-TCCAGCAGCTAAAACTGGTAAGG-3′ |
5′-[FAM]-AAACACCTCTCTTTGTTTGAGCTGTGC-[TAMRA]-3′ |
||||||||||||
|
5. |
Detection and quantification of
European weather loach (Misgurnus fossilis) using digital droplet PCR
targeting the COI gene. This species is cryptic and is facing population
decline in recent times. |
Forward primer |
Reverse primer |
Probe |
Amplicon length (in bp) |
(Brys et al. 2021) |
||||||||
|
5’-CCCCCGACATAGCATTTCCG-3’ |
5’-AACTGTTCAGCCTGTCCCAG-3’ |
5’-
(6-FAM)CTCGTTCCTCCTTCTGCTGG(ZEN/IBFQ)-3’ |
119 |
|||||||||||
|
6. |
Detection of endangered
freshwater or Spectacle case Mussel (Margaritifera monodonta) using
species-specific qPCR primers. |
Forward primer |
Reverse primer |
Probe |
(Lor et al. 2020) |
|||||||||
|
5’-AGTGGGTGATACCWGTATCT-3’ |
5’-TACCCCTAGCACCATTTGAT-3’ |
5’-5HEX/TCTAGCCCT/ZEN/AAGACTATGACAACTTTTCC/3IABkFQ-3’ |
||||||||||||
|
7. |
Monitoring of river systems for
detection of invasive Eastern mosquitofish (Gambusia holbrooki) and
the consequent decline of two endemic species of killifish (Valencia
letourneuxi and Valencia robertae) using species-specific qPCR
targeting the COI region. |
Species |
Forward primer (5’−3’) |
Reverse primer (5’−3’) |
Probe (5’−3’) |
Amplicon length (in bp) |
(Mauvisseau et al. 2020) |
|||||||
|
Valencia letourneuxi |
TGGGGGTTTTGGCAACTGAC |
GGAGGAGAAGAAACGAGGGGGG |
CATAGCCTTCCCTCGGATAAAC |
113 |
||||||||||
|
Valencia robertae |
ATGGCCTTCCCCCGAATGAA |
GCTAAGTTTCCGGCCAGAGG |
CTTCCTCTGGCGTCGAGGC |
137 |
||||||||||
|
Gambusia holbrooki |
GTGCCCCAGACATAGCCTTT |
TACAGAAGGTCCGGCATGTG |
AAGATGCGAGGAGGAGGAGA |
167 |
||||||||||
|
8. |
Detection of endangered Hay’s
Spring Amphipod (Stygobromus hayi) and a co-occurring species of S.
tenuis potomacus in groundwater using species-specific qPCR targeting the
COI region. |
Species |
Forward primer (5’-3’) |
Reverse primer (5’-3’) |
Probe (5’-3’) |
(Niemiller et al. 2018) |
||||||||
|
Stygobromus hayi |
GCATCTGTCGACTTAGCTATT |
CGGCACTTGGTCTATAGTTATT |
6-FAM-TCACTTCATTTAGCAGGAGCCTCCTC-TAMRA |
|||||||||||
|
S. tenuis potomacus |
CTGAACAGTATATCCACCACT |
CATTCCAGGTCTCCGTATATT A |
-6-FAM-TGCAGTAGCCCATAGTGGAGCATCT-TAMRA |
|||||||||||
References
Akamatsu, Y.,
G. Kume, M. Gotou, T. Kono, T. Fujii, R. Inui & Y. Kurita (2020). Using environmental DNA analyses
to assess the occurrence and abundance of the endangered amphidromous fish
Plecoglossus altivelis ryukyuensis. Biodiversity Data Journal 8
:e39679. https://doi.org/10.3897/BDJ.8.e39679
Andruszkiewicz,
E.A., J.R. Koseff, O.B. Fringer, N.T. Ouellette, A.B. Lowe, C.A. Edwards &
A.B. Boehm (2019). Modeling environmental DNA transport in the coastal ocean using
Lagrangian particle tracking. Frontiers in Marine Science 6: 477. https://doi.org/10.3389/fmars.2019.00477
Baker, C.S.,
D. Steel, S. Nieukirk & H. Klinck (2018). Environmental DNA (eDNA) from
the wake of the whales: Droplet digital PCR for detection and species identification.
Frontiers in Marine Science 5: 1021. https://doi.org/10.3389/fmars.2018.00133
Barnes, M.A.
& C.R. Turner (2016). The ecology of environmental DNA and implications for conservation genetics.
Conservation Genetics 17(1): 1–17. https://doi.org/10.1007/s10592-015-0775-4
Barnes, M.A.,
C.R. Turner, C.L. Jerde, M.A Renshaw, W.L Chadderton & D.M. Lodge (2014). Environmental conditions
influence eDNA persistence in aquatic systems. Environmental Science and
Technology 48(3): 1819–1827. https://doi.org/10.1021/es404734p
Bianchi, T.
& E. Morrison (2018). Human Activities Create Corridors of Change in Aquatic Zones. Eos
99(11): 13–15. https://doi.org/10.1029/2018eo104743
Bremmer,
R.H., K.G. De Bruin, M.J.C. Van Gemert,, T.G. Van Leeuwen & M.C.G Aalders
(2012). Forensic
quest for age determination of bloodstains. Forensic Science International
216(1–3): 1–11. https://doi.org/10.1016/j.forsciint.2011.07.027
Brys, R., D.
Halfmaerten, S. Neyrinck, Q. Mauvisseau, J. Auwerx, M. Sweet & J. Mergeay
(2021). Reliable
eDNA detection and quantification of the European weather loach (Misgurnus
fossilis). Journal of Fish Biology 98(2): 399–414. https://doi.org/10.1111/jfb.14315
Capo, E., G.
Spong, S. Norman, H. Königsson, P. Bartels & P. Byström (2019). Droplet digital PCR assays for
the quantification of brown trout (Salmo trutta) and Arctic char (Salvelinus
alpinus) from environmental DNA collected in the water of mountain lakes. PLoS
ONE 14(12): 1–19. https://doi.org/10.1371/journal.pone.0226638
Carmichael,
W.W. (2001). Health
Effects of Toxin-Producing Cyanobacteria: “The CyanoHABs.” Human and
Ecological Risk Assessment: An International Journal Human and Ecological Risk
Assessment 7(5): 1393–1407. https://doi.org/10.1080/20018091095087
Carpenter
R.S. (1981). The American
Naturalist. The American Naturalist 118(3): 372–383.
Clark, D.E.,
C.A. Pilditch, J.K. Pearman, J.I. Ellis & A. Zaiko (2020). Environmental DNA metabarcoding
reveals estuarine benthic community response to nutrient enrichment – Evidence
from an in-situ experiment. Environmental Pollution 267: 115472. https://doi.org/10.1016/j.envpol.2020.115472
Collins,
R.A., O.S. Wangensteen, E.J. O’Gorman, S. Mariani, D.W. Sims & M.J. Genner
(2018). Persistence
of environmental DNA in marine systems. Communications Biology 1(1):
1–11. https://doi.org/10.1038/s42003-018-0192-6
Conley, D.J.,
H.W. Paerl, R.W. Howarth, D.F. Boesch, S.P. Seitzinger, K.E. Havens, C.
Lancelot & G.E. Likens (2009). Controlling eutrophication: phosphorus and nitrogen. Science
323: 1014–1015.
Cowart, D.A.,
K.G.H Breedveld, M.J. Ellis, J.M. Hull & E.R. Larson (2018). Environmental DNA (eDNA)
applications for the conservation of imperiled crayfish (Decapoda: Astacidea)
through monitoring of invasive species barriers and relocated populations. Journal
of Crustacean Biology 38(3): 257–266. https://doi.org/10.1093/jcbiol/ruy007
Craine, J.,
M. Cannon, A. Elmore, S. Guinn & N. Fierer (2017). DNA metabarcoding potentially
reveals multi-assemblage eutrophication responses in an eastern North American
river. BioRxiv 186452. https://doi.org/10.1101/186452
Cristescu,
M.E. & P.D.N. Hebert (2018). Uses and misuses of environmental DNA in biodiversity
science and conservation. Annual Review of Ecology, Evolution, and
Systematics 49: 209–230. https://doi.org/10.1146/annurev-ecolsys-110617-062306
Deiner, K.,
J.C. Walser, E. Mächler & F. Altermatt (2015). Choice of capture and extraction
methods affect detection of freshwater biodiversity from environmental DNA. Biological
Conservation 183: 53–63. https://doi.org/10.1016/j.biocon.2014.11.018
Dejean, T.,
A. Valentini, A. Duparc, S. Pellier-Cuit, F. Pompanon, P. Taberlet & C.
Miaud (2011). Persistence
of environmental DNA in freshwater ecosystems. PLoS ONE 6(8): 8–11. https://doi.org/10.1371/journal.pone.0023398
Dejean, T.,
A. Valentini, C. Miquel, P. Taberlet, E. Bellemain & C. Miaud (2012). Improved detection of an alien
invasive species through environmental DNA barcoding: The example of the
American bullfrog Lithobates catesbeianus. Journal of Applied Ecology
49(4): 953–959. https://doi.org/10.1111/j.1365-2664.2012.02171.x
Deutschmann,
B., A.K. Müller, H. Hollert & M. Brinkmann (2019). Assessing the fate of brown trout
(Salmo trutta) environmental DNA in a natural stream using a sensitive
and specific dual-labelled probe. Science of the Total Environment 655:
321–327. https://doi.org/10.1016/j.scitotenv.2018.11.247
Díaz-Ferguson,
E., J. Herod, J. Galvez & G. Moyer, G (2014). Development of molecular markers
for eDNA detection of the invasive African jewelfish (Hemichromis letourneuxi):
A new tool for monitoring aquatic invasive species in National Wildlife
Refuges. Management of Biological Invasions 5(2): 121–131. https://doi.org/10.3391/mbi.2014.5.2.05
Doi, H., K.
Uchii, T. Takahara, S. Matsuhashi, H. Yamanaka & T. Minamoto (2015). Use of droplet digital PCR for
estimation of fish abundance and biomass in environmental DNA surveys. PLoS
ONE 10(3): 1–11. https://doi.org/10.1371/journal.pone.0122763
Doi, H., T.
Watanabe, N. Nishizawa, T. Saito, H. Nagata, Y. Kameda, N. Maki, K. Ikeda &
T. Fukuzawa, T (2021). On-site environmental DNA detection of species using ultrarapid mobile
PCR. Molecular Ecology Resources 21(7): 2364–2368. https://doi.org/10.1111/1755-0998.13448
Anderson,
D.M., P.M. Glibert & J.M. Burkholder (2002). Harmful algal blooms and
eutrophication: nutrient sources, composition, and consequences. Estuaries 25(4):
704–726.
Dougherty,
M.M., E.R. Larson, M.A. Renshaw, C.A. Gantz, S.P. Egan, D.M. Erickson &
D.M. Lodge (2016). Environmental DNA (eDNA) detects the invasive rusty crayfish Orconectes
rusticus at low abundances. Journal of Applied Ecology 53(3): 722–732. https://doi.org/10.1111/1365-2664.12621
Elberri,
A.I., A. Galal-Khallaf, S.E. Gibreel, S.F. El-Sakhawy, I. El-Garawani, S.
El-Sayed Hassab ElNabi & K. Mohammed-Geba (2020). DNA and eDNA-based tracking of
the North African sharptooth catfish Clarias gariepinus. Molecular and
Cellular Probes 51: 101535. https://doi.org/10.1016/j.mcp.2020.101535
Elbrecht, V.
& F. Leese (2015). Can DNA-based ecosystem assessments quantify species abundance? Testing
primer bias and biomass-sequence relationships with an innovative metabarcoding
protocol. PLoS ONE 10(7): 1–16. https://doi.org/10.1371/journal.pone.0130324
Ficetola,
G.F., J. Pansu, A. Bonin, E. Coissac, C. Giguet-Covex, M. De Barba, L. Gielly,
C.M. Lopes, F. Boyer, F. Pompanon, G. Rayé & P. Taberlet (2015). Replication levels, false
presences and the estimation of the presence/absence from eDNA metabarcoding
data. Molecular Ecology Resources 15(3): 543–556. https://doi.org/10.1111/1755-0998.12338
Fonseca, V. G
(2018). Pitfalls in relative
abundance estimation using edna metabarcoding. Molecular Ecology Resources
18(5): 923–926. https://doi.org/10.1111/1755-0998.12902
Fujiwara, A.,
S. Matsuhashi, H. Doi, S. Yamamoto & T. Minamoto (2016). Use of environmental DNA to
survey the distribution of an invasive submerged plant in ponds. Freshwater
Science 35(2): 748–754. https://doi.org/10.1086/685882
Fukumoto, S.,
A. Ushimaru & T. Minamoto (2015). A basin-scale application of
environmental DNA assessment for rare endemic species and closely related
exotic species in rivers: A case study of giant salamanders in Japan. Journal
of Applied Ecology 52(2): 358–365. https://doi.org/10.1111/1365-2664.12392
Gargan, L.M.,
T. Morato, C.K. Pham, J.A. Finarelli, J.E.L Carlsson & J. Carlsson (2017). Development of a sensitive
detection method to survey pelagic biodiversity using eDNA and quantitative
PCR: a case study of devil ray at seamounts. Marine Biology 164(5): 1–9.
https://doi.org/10.1007/s00227-017-3141-x
Garlapati,
D., B.C. Kumar, C. Muthukumar, P. Madeswaran, K. Ramu & M.V.R. Murthy
(2021). Assessing the
in situ bacterial diversity and composition at anthropogenically active sites
using the environmental DNA (eDNA). Marine Pollution Bulletin 170:
112593. https://doi.org/10.1016/j.marpolbul.2021.112593
Geerts, A.N.,
P. Boets, S. Van den Heede, P. Goethals & C. Van der heyden (2018). A search for standardized
protocols to detect alien invasive crayfish based on environmental DNA (eDNA):
A lab and field evaluation. Ecological Indicators 84: 564–572. https://doi.org/10.1016/j.ecolind.2017.08.068
Gunzburger,
M.S (2007). Evaluation of
seven aquatic sampling methods for amphibians and other aquatic fauna. Applied
Herpetology 4(1): 47–63. https://doi.org/10.1163/157075407779766750
Harper, K.J.,
N.P. Anucha, J.F. Turnbull, C.W. Bean & M.J. Leaver (2018). Searching for a signal: Environmental
DNA (eDNA) for the detection of invasive signal crayfish, Pacifastacus
leniusculus (Dana, 1852). Management of Biological Invasions 9(2):
137–148. https://doi.org/10.3391/mbi.2018.9.2.07
Hinlo, R., D.
Gleeson, M.Lintermans & E.Furlan (2017). Methods to maximise recovery of
environmental DNA from water samples. PLoS ONE 12(6): 1–22. https://doi.org/10.1371/journal.pone.0179251
Hunter, M.E.,
J.A. Ferrante, G. Meigs-Friend & A. Ulmer (2019). Improving eDNA yield and
inhibitor reduction through increased water volumes and multi-filter isolation
techniques. Scientific Reports 9(1): 1–9. https://doi.org/10.1038/s41598-019-40977-w
Jackson, M.,
C. Myrholm, C. Shaw & T. Ramsfield (2017). Using nested PCR to improve
detection of earthworm eDNA in Canada. Soil Biology and Biochemistry
113: 215–218. https://doi.org/10.1016/j.soilbio.2017.06.009
Jiao, N.Z.,
D.K. Chen, Y.M. Luo, X.P. Huang, R. Zhang, H.B. Zhang, Z.J. Jiang & F.
Zhang (2015). Climate
change and anthropogenic impacts on marine ecosystems and countermeasures in
China. Advances in Climate Change Research 6(2): 118–125. https://doi.org/10.1016/j.accre.2015.09.010
Jovel, J., J.
Patterson, W. Wang, N. Hotte, S. O’Keefe, T. Mitchel, T. Perry, D. Kao, A.L.
Mason, K.L. Madsen & G.K.S. Wong (2016). Characterization of the gut
microbiome using 16S or shotgun metagenomics. Frontiers in Microbiology
7: 459. https://doi.org/10.3389/fmicb.2016.00459
Lacoursière-Roussel,
A., G. Côté, V. Leclerc & L. Bernatchez (2016a). Quantifying relative fish
abundance with eDNA: a promising tool for fisheries management. Journal of
Applied Ecology 53(4): 1148–1157. https://doi.org/10.1111/1365-2664.12598
Lacoursière-Roussel,
A., M. Rosabal & L. Bernatchez (2016b). Estimating fish abundance and
biomass from eDNA concentrations: variability among capture methods and
environmental conditions. Molecular Ecology Resources 16(6): 1401–1414. https://doi.org/10.1111/1755-0998.12522
Lacoursière-Roussel,
A., Y. Dubois, E. Normandeau & L. Bernatchez (2016c). Improving herpetological surveys
in eastern North America using the environmental DNA method1. Genome
59(11): 991–1007. https://doi.org/10.1139/gen-2015-0218
Lee, A.H., J.
Lee, J. Noh, C. Lee, S. Hong, B.O. Kwon, J.J. Kim & J.S. Khim (2020). Characteristics of long-term
changes in microbial communities from contaminated sediments along the west
coast of South Korea: Ecological assessment with eDNA and physicochemical
analyses. Marine Pollution Bulletin 160: 111592. https://doi.org/10.1016/j.marpolbul.2020.111592
Leray, M.
& N. Knowlton (2017). Random sampling causes the low reproducibility of rare eukaryotic OTUs
in Illumina COI metabarcoding. PeerJ 3: 1–27. https://doi.org/10.7717/peerj.3006
Li, F., Y.
Peng, W. Fang,, F. Altermatt., Y. Xie, J. Yang & X. Zhang (2018). Application of Environmental DNA
Metabarcoding for Predicting Anthropogenic Pollution in Rivers. Environmental
Science and Technology 52(20): 11708–11719. https://doi.org/10.1021/acs.est.8b03869
Liang, Z.
& A. Keeley (2013). Filtration recovery of extracellular DNA from environmental water
samples. Environmental Science and Technology 47(16): 9324–9331. https://doi.org/10.1021/es401342b
Lor, Y., T.M.
Schreier, D.L. Waller & C.M. Merkes (2020). Using environmental dna (eDNA) to
detect the endangered spectaclecase mussel (margaritifera monodonta). Freshwater
Science 39(4): 837–847. https://doi.org/10.1086/71167
Manu, S.
& G. Umapathy (2021). A Novel Metagenomic Workflow for Biomonitoring across the Tree of Life
using PCR-free Ultra-deep Sequencing of Extracellular eDNA. Authorea
Preprints.
Maruyama, A.,
K. Nakamura, H. Yamanaka, M. Kondoh & T. Minamoto (2014). The release rate of environmental
DNA from juvenile and adult fish. PLoS ONE 9(12): 1–13. https://doi.org/10.1371/journal.pone.0114639
Mauvisseau,
Q., E. Kalogianni, B. Zimmerman, M. Bulling, R. Brys & M. Sweet (2020). eDNA-based monitoring:
Advancement in management and conservation of critically endangered killifish
species. Environmental DNA 2(4): 601–613. https://doi.org/10.1002/edn3.92
McKee, A.M.,
S.F. Spear & T.W. Pierson (2015). The effect of dilution and the
use of a post-extraction nucleic acid purification column on the accuracy,
precision, and inhibition of environmental DNA samples. Biological
Conservation 183: 70–76. https://doi.org/10.1016/j.biocon.2014.11.031
Miralles, L.,
M. Parrondo, A. Hernández de Rojas, E. Garcia-Vazquez. & Y.J. Borrell
(2019). Development
and validation of eDNA markers for the detection of Crepidula fornicata
in environmental samples. Marine Pollution Bulletin 146: 827–830. https://doi.org/10.1016/j.marpolbul.2019.07.050
Morley, S.A.
& B.L. Nielsen (2016). Chloroplast DNA copy number changes during plant development in
organelle DNA polymerase mutants. Frontiers in Plant Science 7: 1–10. https://doi.org/10.3389/fpls.2016.00057
Nazari-Sharabian,
M., S. Ahmad & K. Moses (2018). Climate change and groundwater :
a short review Engineering, Technology and Applied Science Research
8(6): 3668–3672. https://digitalscholarship.unlv.edu/fac_articles/562
Nevers, M.B.,
M.N. Byappanahalli, C.C. Morris, D. Shively, K. Przybyla-Kelly, A.M. Spoljaric,
J. Dickey & E.F. Roseman (2018). Environmental DNA (eDNA): A tool
for quantifying the abundant but elusive round goby (Neogobius melanostomus).
PLoS ONE 13(1): 1–22. https://doi.org/10.1371/journal.pone.0191720
Niemiller,
M.L., M.L. Porter, J. Keany, H. Gilbert, D.W. Fong, D.C. Culver, C.S. Hobson,
K.D. Kendall, M.A. Davis & S.J. Taylor (2018). Evaluation of eDNA for
groundwater invertebrate detection and monitoring: a case study with endangered
Stygobromus (Amphipoda: Crangonyctidae). Conservation Genetics
Resources 10(2): 247–257. https://doi.org/10.1007/s12686-017-0785-2
Oberemm, A.,
J. Becker, G.A. Codd & C. Steinberg (1999). Effects of cyanobacterial toxins
and aqueous crude extracts of cyanobacteria on the development of fish and
amphibians. Environmental Toxicology 14(1): 77–88. https://doi.org/10.1002/(SICI)1522-7278(199902)14:1<77::AID-TOX11>3.0.CO;2-F
Ogram, A.,
G.S. Sayler & T. Barkay (1987). The extraction and purification
of microbial DNA from sediments. Journal of Microbiological Methods
7(2–3): 57–66. https://doi.org/10.1016/0167-7012(87)90025-X
Parsons,
K.M., M. Everett, M. Dahlheim & L. Park (2018). Water, water everywhere:
Environmental DNA can unlock population structure in elusive marine species. Royal
Society Open Science 5(8): 180537. https://doi.org/10.1098/rsos.180537
Paul, J.H.,
W.H. Jeffrey & M.F. DeFlaun (1987). Dynamics of extracellular DNA in
the marine environment. Applied and Environmental Microbiology 53(1):
170–179. https://doi.org/10.1128/aem.53.1.170-179.1987
Pilliod,
D.S., C.S. Goldberg, M.B. Laramie & L.P. Waits (2013a). Application of Environmental DNA
for Inventory and Monitoring of Aquatic Species. United States Geological
Survey, USA, 4 pp. http://www.arlis.org/docs/vol1/F/835572905.pdf
Pilliod,
D.S., C.S. Goldberg, R.S. Arkle & L.P. Waits (2013b). Estimating occupancy and
abundance of stream amphibians using environmental DNA from filtered water
samples. Canadian Journal of Fisheries and Aquatic Sciences 70(8):
1123–1130. https://doi.org/10.1139/cjfas-2013-0047
Pinto, A.J.
& L. Raskin (2012). PCR biases distort bacterial and archaeal community structure in
pyrosequencing datasets. PLoS ONE 7(8): e43093. https://doi.org/10.1371/journal.pone.0043093
Pukk, L., J.
Kanefsky, A.L. Heathman, E.M. Weise, L.R. Nathan, S.J. Herbst, N.M. Sard, K.T.
Scribner & J.D. Robinson (2021). eDNA metabarcoding in lakes to
quantify influences of landscape features and human activity on aquatic
invasive species prevalence and fish community diversity. Diversity and
Distributions 27(10): 2016–2031. https://doi.org/10.1111/ddi.13370
Reji, L.
& C.A. Francis (2020). Metagenome-assembled genomes reveal unique metabolic adaptations of a
basal marine Thaumarchaeota lineage. ISME Journal 14(8): 2105–2115. https://doi.org/10.1038/s41396-020-0675-6
Renshaw,
M.A., B.P. Olds, C.L. Jerde, M.M. Mcveigh & D.M. Lodge (2015). The room temperature
preservation of filtered environmental DNA samples and assimilation into a
phenol-chloroform-isoamyl alcohol DNA extraction. Molecular Ecology
Resources 15(1): 168–176. https://doi.org/10.1111/1755-0998.12281
Sassoubre,
L.M., K.M. Yamahara, L.D. Gardner, B.A. Block & A.B. Boehm (2016). Quantification of Environmental
DNA (eDNA) Shedding and Decay Rates for Three Marine Fish. Environmental
Science and Technology 50(19): 10456–10464. https://doi.org/10.1021/acs.est.6b03114
Schmelzle,
M.C. & A.P. Kinziger (2016). Using occupancy modelling to compare environmental DNA
to traditional field methods for regional-scale monitoring of an endangered
aquatic species. Molecular Ecology Resources 16(4): 895–908. https://doi.org/10.1111/1755-0998.12501
Schmidt,
B.R., M. Kéry, S. Ursenbacher, O.J. Hyman & J.P. Collins (2013). Site occupancy models in the
analysis of environmental DNA presence/absence surveys: A case study of an
emerging amphibian pathogen. Methods in Ecology and Evolution 4(7):
646–653. https://doi.org/10.1111/2041-210X.12052
Sigsgaard,
E.E., I.B. Nielsen, S.S. Bach, E.D. Lorenzen, D.P. Robinson, S.W. Knudsen, M.W.
Pedersen., M.Al Jaidah, L. Orlando, E. Willerslev, P.R. Møller & P.F.
Thomsen (2017). Population
characteristics of a large whale shark aggregation inferred from seawater
environmental DNA. Nature Ecology & Evolution 1(1): 1–4. https://doi.org/10.1038/s41559-016-0004
Smith, V.H.
(1998). Cultural
Eutrophication of Inland, Estuarine, and Coastal Waters, pp. 7–49. In: Pace,
M.L. & P.M. Groffman (eds.). Successes, Limitations, and Frontiers in
Ecosystem Science. Springer, New York, 490 pp. https://doi.org/10.1007/978-1-4612-1724-4_2
Song, J. W.,
M.J. Small & E.A. Casman (2017). Making sense of the noise: The
effect of hydrology on silver carp eDNA detection in the Chicago area waterway
system. Science of the Total Environment 605: 713–720. https://doi.org/10.1016/j.scitotenv.2017.06.255
Stepien,
C.A., M.R. Snyder & A.E. Elz (2019). Invasion genetics of the silver carp
Hypophthalmichthys molitrix across North America: Differentiation of fronts,
introgression, and eDNA metabarcode detection. PLoS One 14(3):
e0203012.
Sutter, M.
& A.P. Kinziger (2019). Rangewide tidewater goby occupancy survey using environmental DNA. Conservation
Genetics 20(3): 597–613. https://doi.org/10.1007/s10592-019-01161-9
Tillotson,
M.D., R.P. Kelly, J.J. Duda, M. Hoy, J. Kralj & T.P. Quinn (2018). Concentrations of environmental
DNA (eDNA) reflect spawning salmon
abundance at fine spatial and temporal scales. Biological Conservation
220: 1–11. https://doi.org/10.1016/j.biocon.2018.01.030
Petty, J.T.,
J.L. Hansbarger, B.M. Huntsman & P.M. Mazik (2012). Brook trout movement in response
to temperature, flow, and thermal refugia within a complex Appalachian
riverscape. Transactions of the American Fisheries Society 141(4):
1060–1073. https://doi.org/10.1080/00028487.2012.681102
Tran, P.Q.,
S.C. Bachand, P.B. McIntyre, B.M. Kraemer, Y. Vadeboncoeur, I.A. Kimirei, R.
Tamatamah, K.D. McMahon & K. Anantharaman (2021). Depth-discrete metagenomics
reveals the roles of microbes in biogeochemical cycling in the tropical
freshwater Lake Tanganyika. ISME Journal 1971–1986. https://doi.org/10.1038/s41396-021-00898-x
Wilcox, T.M.,
K.S. McKelvey, M.K. Young, S.F. Jane, W.H. Lowe, A.R. Whiteley & M.K.
Schwartz (2013). Robust
Detection of Rare Species Using Environmental DNA: The Importance of Primer
Specificity. PLoS ONE 8(3): e59520. https://doi.org/10.1371/journal.pone.0059520
Wilcox, T.M.,
K.S. McKelvey, M.K. Young, W.H. Lowe & M.K. Schwartz (2015). Environmental DNA particle size
distribution from Brook Trout (Salvelinus fontinalis). Conservation Genetics
Resources 7(3): 639–641. https://doi.org/10.1007/s12686-015-0465-z
Williams,
K.E., K.P. Huyvaert & A.J. Piaggio (2016). No filters, no fridges: A method
for preservation of water samples for eDNA analysis. BMC Research Notes
9(1): 1–5. https://doi.org/10.1186/s13104-016-2104-5
Xie, Y., X.
Zhang, J. Yang, S. Kim, S. Hong, J.P. Giesy, U.H. Yim, W.J. Shim, H. Yu &
J.S. Khim (2018). eDNA-based bioassessment of coastal sediments impacted by an oil spill.
Environmental Pollution 238: 739–748. https://doi.org/10.1016/j.envpol.2018.02.081
Xu, C.L.,
B.H. Letcher & K.H. Nislow (2010). Size-dependent survival of brook
trout Salvelinus fontinalis in summer: Effects of water temperature and stream
flow. Journal of Fish Biology 76(10): 2342–2369. https://doi.org/10.1111/j.1095-8649.2010.02619.x
Yang, J.
& X. Zhang (2020). eDNA metabarcoding in zooplankton improves the ecological status
assessment of aquatic ecosystems. Environment International 134: 105230.
https://doi.org/10.1016/j.envint.2019.105230
Yoshitake, K., T. Yoshinaga, C.
Tanaka, N. Mizusawa, M. Reza, A. Tsujimoto, T. Kobayashi & S. Watabe
(2019). HaCeD-Seq: a
novel method for reliable and easy estimation about the fish population using
haplotype count from eDNA. Marine Biotechnology 21(6):
813–820. https://doi.org/10.1007/s10126-019-09926-6