Journal of Threatened Taxa | www.threatenedtaxa.org | 26 August 2022 | 14(8): 21605–21611

ISSN 0974-7907 (Online) | ISSN 0974-7893 (Print)

https://doi.org/10.11609/jott.6900.14.8.21605-21611

#6900 | Received 17 November 2020 | Final received 09 August 2022 | Finally accepted 11 August 2022

DNA barcoding of a lesser-known catfish, Clupisoma bastari (Actinopterygii: Ailiidae) from Deccan Peninsula, India

Boni Amin Laskar ¹, Harikumar Adimalla ², Shantanu Kundu ³, Deepa Jaiswal ⁴ & Kailash Chandra ⁵

^1,4 Freshwater Biology Regional Centre, Zoological Survey of India, Attapur, Hyderabad 500032, India.

² House No. 2-60, Village Turkapalle, Nalgonda, Telangana 508266, India.

³ Centre for DNA Taxonomy, Molecular Systematics Division, Zoological Survey of India, M Block, New Alipore, Kolkata, West Bengal 700053, India.

⁵ Zoological Survey of India, Prani Vigyan Bhawan, M Block, New Alipore, Kolkata- 700053, West Bengal, India.

¹ boniamin.laskar@gmail.com (corresponding author), ² harikumaradimalla92@gmail.com, ³ shantanu1984@gmail.com, ⁴ deepajzsi@gmail.com, ⁵ kailash616@gmail.com

Editor: Neelesh Dahanukar, Shiv Nadar University, Noida, India. Date of publication: 26 August 2022 (online & print)

Citation: Laskar, B.A., H. Adimalla, S. Kundu, D. Jaiswal & K. Chandra (2022). DNA barcoding of a lesser-known catfish, Clupisoma bastari (Actinopterygii: Ailiidae) from Deccan Peninsula, India. Journal of Threatened Taxa 14(8): 21605–21611. https://doi.org/10.11609/jott.6900.14.8.21605-21611

Copyright: © Laskar et al. 2022. Creative Commons Attribution 4.0 International License. JoTT allows unrestricted use, reproduction, and distribution of this article in any medium by providing adequate credit to the author(s) and the source of publication.

Funding: The research is funded by the Core Funding of Zoological Survey of India (ZSI), Kolkata, Ministry of Environment, Forest and Climate Change (MoEF&CC), New Delhi.

Competing interests: The authors declare no competing interests.

Author details: Boni Amin Laskar is currently working as Scientist-E in High Altitude Regional Centre of Zoological Survey of India, Solan. His field of research is molecular studies & taxonomy of freshwater fishes. He has over 20 years of research experience including field surveys throughout various Biogeographic zones in India. Harikumar Adimalla is a budding researcher in the field of molecular studies of freshwater fishes from Deccan peninsular biogeographic zone. Shantanu Kundu is a molecular biologist with over 10 years of experience including field surveys and molecular studies of Indian fauna, especially the Himalayan and northeastern Indian region. He is currently working as a post-doctoral fellow in the Department of Marine Biology, Pukyong National University, Busan, South Korea. Deepa Jaiswal is working as Scientist-E in Freshwater Biology Regional Centre of Zoological Survey of India, Hyderabad. Her field of specialization is taxonomy of aquatic Insects. Kailash Chandra is the former Director of Zoological Survey of India. He is a renowned taxonomist in India and is a recipient of E.K. Janaki Ammal National Award on taxonomy.

Author contributions: BAL & HA did field surveys and collected the specimens. BAL studied the morphology and meristics of the specimens for taxonomic identification. HA generated the DNA data. BAL & SK did the molecular analysis. BAL, SK & DJ wrote the article. BAL & KC reviewed the article.

Acknowledgements: We are grateful to the Director of Zoological Survey of India, Kolkata, Dr. Dhriti Banerjee, for her support and enthusiasm, and for providing necessary facilities for the study. The third author (SK) acknowledges the fellowship grant received from the Council of Scientific and Industrial Research (CSIR) Senior Research Associateship (Scientists’ Pool Scheme) Pool No. 9072-A.

Abstract: DNA barcoding substantiates species identification, and simultaneously indicates the misnomer taxa. Based on the morphological descriptions, we identified a lesser-known catfish, Clupisoma bastari, from Godavari River basin, and contributed novel DNA barcode data to the GenBank. The Kimura 2 parameter genetic divergence between species, and the neighbour-joining phylogeny clearly depicted a distinct clade of C. bastari in the studied dataset. Clupisoma bastari maintained sufficient K2P genetic divergence (8.3% to 11.2%) with other congeners, and branched as a sister-species of C. garua. The present study highlights possible existence of a few misnomer taxa in the GenBank. We encourage further extensive sampling of different congeners of Clupisoma from a wide range of habitats to explore the species diversity and phylogenetic relationship.

Keywords: Eastern Ghats, ichthyology, species identification, taxanomy.

Introduction

The genus Clupisoma Swainson is classified under a newly set up family Ailiidae, and is currently comprised of nine valid species (Wang et al. 2016; Fricke 2020), distributed across Salween basin in Yunnan, China, to westward Indus basin in Pakistan (Jayaram 1977; Ferraris 2004; Chen et al. 2005). Among them, four species are distributed in Indus, Ganges, Brahmaputra, and Godavari basins, in India. Clupisoma bastari Datta & Karmakar (1980) was described from Indravathi River, a tributary of river Godavari in peninsular India. Due to its limited distribution, the species has been poorly studied, and it was once categorized as ‘Endangered’ (Molur & Walker 1998). The species is currently categorized as ‘Data Deficient’ in the International Union for Conservation of Nature Red List and referred to as extant resident of the State Chattisgarh in central India (Dahanukar 2011). Apart from a few studies on the length-weight relationship, and food and feeding habit, on a collection of specimens during 1997–98 from upper Godavari basin (Bhowate & Mulgir 2006, 2009), the species was sometime reported from Ravi Shankar Sagar reservoir and from Tapti river in the central Mahanadi basin (Desai & Srivastava 2004; Siddiqui & Pervin 2017). C. bastari was not enlisted in the updated checklist of ichthyofauna of Eastern Ghats as well as studies from other localities within the Deccan Peninsula (Barman 1993; Devi & Indra 2003; Johnson et al. 2012; Laxammappa & Bakshi 2016). C. bastari has been presumably overlooked in the earlier studies due to misidentification of Clupisoma congeners in India.

Besides traditional taxonomy, the molecular data is effectively evidenced to identify and distinguish freshwater fishes around the world (Hubert et al. 2008; Ward et al. 2009; Steinke et al. 2009; April et al. 2011; Collins et al. 2012). Several small to large-scale attempts have been endeavored to build-up the DNA barcode reference library of freshwater fishes from India and neighboring countries, aiming to quick and reliable species identification and to illuminate species diversity from different biogeographic zones (Khedkar et al. 2014; Chen et al. 2015; Barman et al. 2018; Laskar et al. 2018; Kundu et al. 2019; Rahman et al. 2019). Although, the GenBank database holds several publicly available DNA barcode sequences of Clupisoma species, the genetic information on C. bastari was lacking. We studied C. bastari from central Godavari basin surrounding its type locality and generated the DNA barcode data to fill the gap of knowledge.

Materials and methods

Specimens of Clupisoma garua were collected from Mahanadi river basin, Odisha; and C. bastari from two different localities in Godavari River basin in Deccan Peninsula, India (Figure 1). The specimens are registered in the National Zoological Collections of Zoological Survey of India, Hyderabad. Clupisoma garua, FBRC/ZSI/F2445, ex 1, 190 mm SL; Odisha, Ib river, near Jharsuguda-Raigarh road, about 30 Km from Hirakud reservoir, 21.866N 83.951E, 28 August 2017; C. bastari, FBRC/ZSI/F2410, ex 1, 185 mm SL; Telangana, Sriram Sagar Reservoir, 18.99N 78.31E, 13 June 2017; and C. bastari, FBRC/ZSI/F3461, ex 1, 122 mm SL, Telangana, Godavari-Sabri confluence, near Konavaram bridge, 17.56N 81.26E, 24 November 2019.

The genomic DNA was extracted through QIAamp DNA Mini Kit (Qiagen, Valencia, CA) following manufacturer’s procedures. The published primer pair (Ward et al. 2005): FishF1-5′TCAACCAACCACAAAGACATTGGCAC3′ and FishR1-5′TAGACTTCTGGGTGGCCAAAGAATCA3′ was used to amplify the partial cytochrome oxidase subunit I gene (mtCOI) in a Veriti® Thermal Cycler (Applied Bio systems, Foster City, CA). The 30 µl PCR mixture contains 10 pmol of each primer, 100 ng of DNA template, 1 × PCR buffer, 1.0–1.5 mM of MgCl2, 0.25 mM of each dNTPs, and 1U of Taq polymerase (Takara BIO Inc., Japan). The thermal profile comprised of an initial step of 2 min at 95 °C followed by 35 cycles of 0.5 min at 94 °C, 0.5 min at 54 °C, and 1 min at 72 °C, followed in turn by 10 min at 72 °C and subsequent hold at 4°C. The PCR products were further purified using QIAquickR Gel extraction Kit (Qiagen, Valencia, CA). The cycle sequencing and Sanger sequencing was executed commercially. Both forward and reverse chromatograms were checked through SeqScanner V1.0 (Applied Biosystems Inc., CA, USA), nucleotide BLAST (https://blast.ncbi.nlm.nih.gov/), and ORF finder (https://www.ncbi.nlm.nih.gov/orffinder/) to trim the low quality reads and gaps. The COI barcode sequences of C. bastari and C. garua generated in this study are available in GenBank and the accession numbers are reflected in the phylogenetic tree. Further, the sequences of nominal Clupisoma congeners were downloaded from the GenBank database to form a combined dataset for estimating genetic distance and phylogenetic analysis. However, a few sequences of nominal C. garua (accession numbers: KX455904, FJ459470, FJ459471, and MN259175) were not included in the final dataset assuming that these are probably conspecifics of Silonia silondia as observed in test of phylogeny covering all the available sequences of the family Ailiidae and Scilbeidae from NCBI database. The sequence of Ailia coila (MN083152) was used as an out-group in the phylogenetic analysis of the Clupisoma congeners. The dataset was aligned using ClustalX (Thompson et al. 1997) and Kimura 2 parameter (K2P) genetic distances and neighbor-joining phylogeny using K2P were generated by using MEGAX (Kumar et al. 2018).

Results

The specimens were morphologically identified following the taxonomic descriptions (Hamilton 1822; Hora 1937; Datta & Karmakar 1980; Ferraris 2004). Clupisoma bastari (Image 1) is identified based on the combination of following morphological characters: body elongate and compressed, abdominal edge keeled from vent to thorax, snout bluntly pointed, eyes large, visible from ventral surface, mouth subterminal, cresentic, upper jaw slightly longer, teeth villiform in bands in both jaws, vomero-palatine band interrupted in middle. Median longitudinal groove on upper surface of head extends to hind border of eye. Barbels four pairs, maxillary barbels extending to anal fin base, inner mandibular barbels longer than outer mandibular barbels, both the mandibular barbels are longer than head, nasal barbels extend to posterior edge of eye. Rayed dorsal-fin inserted above middle of pectoral-fin, dorsal-fin with a strong spine serrated internally, adipose dorsal-fin above the last quarter of anal-fin base, pectoral-fin with a strong spine serrated internally, pelvic-fin ends before anal opening, caudal-fin deeply forked.

Although, the length of maxillary barbel and the extend of keel in abdominal edge place C. bastari in between C. garua (Hamilton, 1822) and C. prateri (Hora, 1937), but it is sufficiently distinct from them by the combination of other morphological characters, such as lengths of pectoral fins and maxillary barbels. Further, in C. garua, adipose fin is absent and anal fin is short while in the Burmese species C. prateri, the branched anal fin rays counts in the range from 37 to 42 (modally 39) and the abdominal edge keeled throughout. However, in C. prateri, maxillary barbel extends up to middle of pelvic, mandibular barbel reaches base of pectoral, and pectoral reaches pelvic origin. These morphological differences are sometime indiscernible leading to incorrect identification among the three species.

The generated DNA barcodes of C. bastari (accession numbers: MF601325 and MT821302) maintained 9.9% K2P genetic divergence with our generated sequence of C. garua (accession number: MG572775) as well as with the database sequences of topotypic C. garua, and similarly with the other congeners (Table 1). The NJ phylogeny revealed the occurrence of four species clades with a distinct lineage of C. bastari (Clade-2) in the studied dataset (Figure 2). The Clade-1 is unexpectedly included by sequences of three following nominal taxa maintaining very low genetic divergence of 0.6%: our own studied C. garua (Mahanadi River basin), C. garua (Barak River basin, Ganges River basin, and Narmada River basin in India; Surma River basin, Meghna River basin, and Sundarbans in Bangladesh), C. prateri (Narmada River basin in India, and Surma River basin and Sundarbans in Bangladesh), and C. longianalis (Huang, 1981) (Mekong River near its type locality).

The present genetic analysis evidenced the presence of misnomer taxa named as C. prateri and C. longianalis nested in C. garua clade-1 (Figure 2). The studied species, C. bastari (Clade-2) along with one database sequence (Clupisoma sp. JX260854 generated from Godavari River) showed 0.2% intra-species genetic divergence and maintained 9.9% K2P genetic divergence with C. garua (Clade-1) and 10.0–11.2% with other two clades (Clade-3 and Clade-4) (Table 1). The Clade-3 is comprising of three database sequences of C. sinense from Mekong basin. The Clade-4 is comprising of two database sequences (Accessions: MN178280 and KY909150) with the name C. garua, but the clade is distinct from the topotypic C. garua (clade-1) and also maintains sufficient species level genetic distance with the congeners. In NCBI database, no sequence is available with the name C. Montana. However, the two sequences (MN178280 from Ghaghara River, Nepal; KY909150 from Ranganadi River, Arunachal Pradesh, India) are presumed as possible lineage of C. montana and tentatively assigned as C. Montana having type locality in Teesta River, India.

The BIN list in public data portal in Boldsystem revealed four distinct BINs in the Clupisoma. The species, C. bastari, was assigned a distinct BIN: BOLD:ABY1142. There are two different BINs for the sequences named as C. garua. A few of the sequences named as C. prateri are included in one of the BINs of C. garua. Similarly, two sequences included in one of the BINs of C. garua appear as a misidentified case which we tentatively assigned as C. Montana.

Discussion

Among all the congeners, C. garua is a widely distributed species and listed frequently in several freshwater fish inventories (Gupta & Banerjee 2016; Bhakta & Sonia 2020). However, the report of occurrence of C. garua from Godavari basin is doubtful. One of the sequences of C. garua from Barak River basin (JN628921) in this clade-1 was also morphologically identified as C. garua by the first author in previous studies (Bhattacharjee et al. 2012). Further, the sequences (JX983272 to JX983278) named as C. prateri sampled from Narmada basin have been corrected as C. garua (Khedkar et al. 2014). Nevertheless, C. prateri was originally described from Irrawady drainage in Myanmar. Later on, another species C. roosae Ferraris (2004) was described from the same river. But, no sequence information is available for C. roosae. Although, plethora of studies suggest the occurrence of C. garua in south Indian waters, but, no such specimen was observed in the Krishna River in Andhra Pradesh and the Godavari River in Telangana. We suggest further examination of C. garua using molecular data from southern Indian waters.

Based on the morphological characters, C. montana and C. naziri Mirza & Awan (1973) (type locality Indus River basin Pakistan) were placed into one group having abdominal edge rounded while that is keeled in C. garua, C. bastari, and C. prateri (Datta & Karmakar 1980). Clupisoma montana is also a poorly known species and has been occasionally reported from central India (Johnson et al. 2012), Bihar (Gunasekar & Isaac 2017) and part of lower Brahmaputra basin in Assam (Saha & Bordoloi 2009). Besides, a few haematological and biological studies on C. Montana are also available (Grover et al. 1999). Therefore, further DNA barcode data of C. montana from its type locality will ease to understand the phylogeny and distribution of this species in a precise manner.

DNA barcoding uses genetic information of an agreed upon segment of mtCOI gene for efficient discrimination of animal taxa at species level (Hebert et al. 2003). With the application of this advanced technique, taxonomic comparison becomes an easy task (Tautz et al. 2002). This tool also effectively utilized for below the species level identification, cryptic species or species-complex detection through intra- and inter-species barcode gap assessment (Blaxter 2003). With the improving trends in DNA barcoding, the ichthyofaunal diversity has been largely explored throughout the world including India. As of now a total of 11,613 DNA barcode sequences of class Actinopterygii have been generated from different biogeographic realms in India and deposited in the Barcode of Life data system (Accessed on 3 August 2020), and even GenBank consisted more than that. The present study contributes novel barcode sequences of morphologically identified lesser-known C. bastari to the GenBank database.

Data availability

The data that support the findings of this study are openly available at NCBI GenBank database at (https://www.ncbi.nlm.nih.gov) with the accession number (MF601325, MG572775, and MT821302), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Table 1. The estimated inter- and intra-species genetic divergence in Clupisoma congeners.

Grouped Taxa/Clades	Between groups K2P (%)			Within group K2P (%)
	1	2	3
1. C. garua (clade-1)				0.65
2. C. bastari (clade-2)	10.1			0.19
3. C. sinense (clade-3)	10.4	10.3		1.20
4. C. montana (clade-4)	10.9	11.2	10.0	0.16

For figures & image - - click here for full PDF

References

April, J., R.L. Mayden, R.H. Hanner & L. Bernatchez (2011). Genetic calibration of species diversity among North America’s freshwater fishes. Proceedings of the National Academy of Sciences 108: 10602–10607.

Armstrong, K.F. & S.L. Ball (2005). DNA barcodes for biosecurity: invasive species identification. Philosophical Transactions of the Royal Society B Biological 360: 1813–1823.

Barman, A.S., M. Singh, S.K. Singh, H. Saha, Y.J. Singh, M. Laishram & P.K. Pandey (2018). DNA Barcoding of Freshwater Fishes of Indo-Myanmar Biodiversity Hotspot. Scientific Reports 8: 8579.

Barman, R.P. (1993). Freshwater fishes. State Fauna Series 5, Fauna of Andhra Pradesh Pt-I: 334 pp.

Bergsten, J., D.T. Bilton, T. Fujisawa, M. Elliott, M.T. Monaghan, M. Balke, L. Hendrich, J. Geijer, J. Herrmann, G.N. Foster, I. Ribera, A.N. Nilsson, T.G. Barraclough & A.P. Vogler (2012). The effect of geographical scale of sampling on DNA barcoding. Systematic Biology 61: 851–869.

Bhakta, D. & Sonia (2020). Review on Clupisoma garua (Hamilton, 1822), an inhabitant species in inland open waters of India. Innovative Farming 5(1): 25–29.

Bhattacharjee, M.J., B.A. Laskar, B. Dhar & S.K. Ghosh (2012). Identification and Re-Evaluation of Freshwater Catfishes through DNA Barcoding. PLoS One 7: e49950.

Bhowate, C.S. & M.T. Mulgir (2006). Length-Weight relationship in the catfish Clupisoma bastari, pp. 27–35. In: Pandey, B.N. (ed.). Ecology and Environment. APH Publishing Corporation, 384 pp.

Bhowate, C.S., M.T. Mulgir & A.N. Kulkarni (2009). Food and feeding habits of Clupisoma bastari Datta and Karmakar inhibiting Godavari River, Nanded, Maharashtra. Bioinfolet 6(1): 55–56.

Blaxter, M. (2003). Molecular systematics: counting angels with DNA. Nature 421: 122–124.

Chen, W., X. Ma Shen, Y.Y. Mao & S. He (2015). The fish diversity in the upper reaches of the Salween River, Nujiang River, revealed by DNA barcoding. Scientific Reports 5: 17437.

Chen, X.Y., C.J. Ferraris & J.X. Yang (2005). A new species of catfish of the genus Clupisoma (Siluriformes: Schilbeidae) from the Salween River, Yunnan, China. Copeia 2005: 566–570.

Collins, R.A. & R.H. Cruickshank (2013). The seven deadly sins of DNA barcoding. Molecular Ecology Resources 13: 969–975.

Collins, R.A., K.F. Armstrong, R. Meier, Y. Yi, S.D. Brown, R.H. Cruickshank, S. Keeling & C. Johnston (2012). Barcoding and border biosecurity: identifying cyprinid fishes in the aquarium trade. PLoSOne 7: e28381.

Dahanukar, N. (2011). Clupisoma bastari. The IUCN Red List of Threatened Species 2011: e.T168352A6481275. Accessed on 4^th August 2020. https://doi.org/10.2305/IUCN.UK.2011-1.RLTS.T168352A6481275.en

Datta, A.K. & A.K. Karmakar (1980). Clupisoma bastari sp. nov. (Pisces: Schilbeidae) from Bastar, Madhya Pradesh, India. Bulletin, Zoological Survey of India 2(2&3): 193–196.

Desai, V.R. & N.P. Shrivastava (2004). Ecology and fisheries of Ravishankar Sagar Reservoir. Central Inland Fisheries Research Institute (CIFRI) 126: 1–37.

DeSalle, R. & P. Goldstein (2019). Review and Interpretation of Trends in DNA Barcoding. Frontiers in Ecology and Evolution 7: 302.

Ferraris, C.J. (2004). A new species of the Asian schilbid catfish genus Clupisoma from Myanmar, with a redescription of Clupisoma prateri Hora (Osteichthyes: Siluriformes: Schilbidae). Zootaxa 437: 1–10.

Fricke, R. (2020). Eschmeyer’s catalog of fishes: References. http://researcharchive.calacademy.org/research/ichthyology/catalog/fishcatmain.asp. Accessed on 4^th August 2020.

Grover, S.P., J.V.S. Rauthan & G. Rawat (1999). Haematological studies on a hill stream fish Clupisoma montana (Hora) of Garhwal Himalaya. Indian Journal of Physical and Natural Sciences Section A 15: 4–6.

Gunasekar, A. & S.S. Isaac (2017). The Biodiversity of fish fauna in Indrapuri Dam Rohtas district, Bihar (India). International Journal of Fisheries and Aquatic Studies 5(2): 416–419.

Gupta, S. & S. Banerjee (2016). A note on Clupisoma garua (Hamilton, 1822), a freshwater catfish of Indian subcontinent (Teleostei: Siluriformes). Iranian Journal of Ichthyology 3: 150–154.

Hamilton, F. (1822). An account of the fishes of the River Ganges and its branches. George Ramsay and Co., London, vii + 405 pp., 39 pls. https://doi.org/10.5962/bhl.title.59540

Hubbs, C.L. & K.F. Lagler (1947). Fishes of the Great Lakes Region. Cranbook Institute Science Bulletin 26: 1–186.

Hebert, P.D.N., A. Cywinska, L. Shelley & J.R.B. de Waard (2003). Biological identifications through DNA barcodes. Proc. R. Soc. Lond. B Biol. Sci. 270: 313-321.

Hora, S.L. (1937). The game fishes of India. III “garua bachcha or gaurchcha”, Clupisoma garua (Hamilton) and two allied species. Journal of the Bombay Natural History Society 39: 659–678.

Huang, S.Y.  (1981). On two new species of the catfish genus Platytropius Hora from Yunnan, China. Acta Zootaxonomica Sinica 6 (4): 437–440.

Hubert, N., R. Hanner, E. Holm, N.E. Mandrak, E. Taylor, M. Burridge, D. Watkinson, P. Dumont, A. Curry, P. Bentzen, J. Zhang, J. April & L. Bernatchez (2008). Identifying Canadian Freshwater Fishes through DNA Barcodes. PLoSOne 3: e2490.

Jayaram, K.C. (1977). Aid to the identification of siluroid fishes of India, Burma, Sri Lanka, Pakistan and Bangladesh. 2. Siluridae, Schilbeidae, Pangasidae, Amblycipitidae, Akysidae. Records of the Zoological Survey of India, Miscellaneous Publication, Occassional Paper 10: 1-33.

Johnson, J.A., R. Parmar, K. Ramesh, S. Sen & M. Sreenivasa (2012). Fish diversity and assemblage structure in Ken River of Panna landscape, central India. Journal of Threatened Taxa 4(13): 3161-3172. https://doi.org/10.11609/JoTT.o3024.3161-72

Khedkar, G.D., R. Jamdade, S. Naik, L. David & D. Haymer (2014). DNA barcodes for the fishes of the Narmada, one of India’s longest rivers. PLoSOne 9: e101460.

Kumar, S., G. Stecher, M. Li, C. Knyaz & K. Tamura (2018). MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Molecular Biology and Evolution 35: 1547–1549.

Kundu, S., K. Chandra, K. Tyagi, A. Pakrashi & V. Kumar (2019). DNA barcoding of freshwater fishes from Brahmaputra River in Eastern Himalaya biodiversity hotspot. Mitochondrial DNA Part B 4: 2411–2419.

Laskar, B.A., V. Kumar, S. Kundu, K. Tyagi & K. Chandra (2018). Taxonomic quest: validating two mahseer fishes (Actinopterygii: Cyprinidae) through molecular and morphological data from biodiversity hotspots in India. Hydrobiologia 815: 113–124.

Laxmappa, B. & R.R. Bakshi (2016). A Checklist of fishes of Telangana State, India. International Journal of Fisheries and Aquatic Studies 4(4): 35-42.

Lipscomb, D., N. Platnick & Q. Wheeler (2003). The intellectual content of taxonomy: a comment on DNA taxonomy. Trends in Ecology & Evolution 18: 65–66.

Meier, R., G. Zhang & F. Ali (2008). Te use of mean instead of smallest interspecifc distances exaggerates the size of the “barcoding gap” and leads to misidentifcation. Systematic Biology 57: 809–813.

Mirza, M.R. & M.I. Awan  (1973). Two new catfishes (Pisces, Siluriformes) from Pakistan. Biologia (Lahore) 19(1-2): 145–159.

Molur, S. & S. Walker (eds.) (1998). Conservation assessment and management plan for freshwater fishes of India. Workshop Report. Zoo Outreach Organization, Coimbatore/CBGS and NBFGR, Lucknow, India, 158 pp.

Moritz, C. & C. Cicero (2004). DNA barcoding: promise and pitfalls. PLoSBiol. 2: e354.

Rahman, M.M., M. Norén, A.R. Mollah & S.O. Kullander (2019). Building a DNA barcode library for the freshwater fishes of Bangladesh. Scientific Reports 9: 9382.

Rema Devi, K. & T.J. Indra (2003). An updated checklist of ichthyofauna of Eastern Ghats. Zoos’ Print Journal 18(4): 1067-1070.

Saha, S. & S. Bordoloi (2007). Ichthyofaunal diversity of two beels of Goalpara District, Assam, India. Journal of Threatened Taxa 1(4): 240–242. https://doi.org/10.11609/JoTT.o1806.240-2

Shen, Y.Y., X. Chen & R.W. Murphy (2013). Assessing DNA barcoding as a tool for species identification and data quality control. PLoSOne 8: e57125.

Siddiqui, A. & S. Pervin (2017). Study of ichthyofaunal diversity of Tapti River of Burhanpur District (M. P.). Life Science Bulletin 14(2): 185–188.

Steinke, D., T.S. Zemlak & P. Hebert (2009). Barcoding Nemo: DNA-based identifications for the ornamental fish trade. PLoSOne 4: e6300.

Stoeckle, M. (2003). Taxonomy, DNA, and the bar code of life. Bioscience 53: 796–797.

Tautz, D., P. Arctander, A. Minelli, R.H. Thomas & A.P. Vogler (2002). DNA points the way ahead in taxonomy. Nature 418: 479–479.

Tautz, D., P. Arctander, A. Minelli, R.H. Thomas & A.P. Vogler (2003). A plea for DNA taxonomy. Trends in Ecology & Evolution 18: 70–74.

Thompson, J.D., T.J. Gibson, F. Plewniak, F. Jeanmougin & D.G. Higgins (1997). The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25: 4876–4882.

Wang, J., B. Lu, R. Zan, J. Chai, W. Ma, W. Jin, R. Duan, J. Luo, R.W. Murphy, H. Xiao & Z. Chen (2016). Phylogenetic Relationships of Five Asian Schilbid Genera Including Clupisoma (Siluriformes: Schilbeidae). PLoS One 11: e0145675.

Ward, R.D., R. Hanner & P.D.N. Hebert (2009). The campaign to DNA barcode all fishes, FISH-BOL. Journal of Fish Biology 74: 329–356.

Ward, R.D., T.S. Zemlak, B.H. Innes, P.R. Last & P.D.N. Hebert (2005). DNA barcoding of Australia’s fish species. Philosophical Transactions of the Royal Society B Biological 360: 1847–1857.