Journal of Threatened Taxa | www.threatenedtaxa.org | 26
December 2019 | 11(15): 14942–14954
Revisiting
genetic structure of Wild Buffaloes Bubalus
arnee Kerr, 1792 (Mammalia: Artiodactyla: Bovidae) in Koshi Tappu Wildlife Reserve,
Nepal: an assessment for translocation programs
Ram C. Kandel 1, Ram C. Poudel 2,
Amir Sadaula 3, Prakriti Kandel 4,
Kamal P. Gairhe 5, Chiranjibi
P. Pokheral 6, Siddhartha B. Bajracharya 7, Mukesh K. Chalise 8 & Ghan Shyam Solanki 9
1,5 Ministry
of Forests and Environment, Department of National Parks and Wildlife
Conservation, PO 860,
Babarmahal, Nepal.
2 Nepal Academy
of Science and Technology, Molecular Biotechnology Unit, PO 3323, Khumaltar, Nepal.
3,6,7 National
Trust for Nature Conservation, PO 3712, Khumaltar,
Nepal.
4 Kathmandu
University, Department of Biotechnology, PO 6250, Dhulikhel,
Nepal.
5 Chitwan
National Park, Headquarter, Kasara, Chitwan, Nepal.
8 Tribhuvan
University, Central Department of Zoology, Kirtipur,
Nepal.
9 Mizoram
University, Department of Zoology, Mizoram, Aizawl, Mizoram 796009, India.
1 rckandel06@gmail.com,
2 ramc_poudel@yahoo.com (corresponding author), 3naturalamir@gmail.com,
4 88prakriti88@gmail.com,
5 kamalgairhe@hotmail.com, 6pokheralchiran@gmail.com, 7
sid.bajracharya@gmail.com,
8
mukesh57@hotmail.com, 9gssolanki02@yahoo.co.in
doi: https://doi.org/10.11609/jott.4940.11.15.14942-14954
Editor:
David
Mallon, Manchester Metropolitan University, Derbyshire, UK. Date of
publication: 26 December 2019 (online & print)
Manuscript
details: #4940 | Received 01
March 2019 | Final received 16 November 2019 | Finally accepted 27 November
2019
Citation: Kandel, R.C., R.C. Poudel, A. Sadaula, P. Kandel, K.P. Gairhe,
C.P. Pokheral, S.B. Bajracharya,
M.K. Chalise & G.S. Solanki (2019). Revisiting
genetic structure of Wild Buffaloes Bubalus
arnee Kerr, 1792 (Mammalia: Artiodactyla:
Bovidae) in Koshi Tappu Wildlife Reserve, Nepal: an assessment for
translocation programs. Journal of Threatened Taxa 11(15): 14942–14954.
https://doi.org/10.11609/jott.4940.11.15.14942-14954
Copyright: © Kandel et al. 2019. Creative Commons Attribution 4.0 International
License. JoTT
allows unrestricted use, reproduction, and distribution of this article in any
medium by adequate credit to the author(s) and the source of publication.
Funding: The blood and faecal sample collection for this study was supported by Harioban Program. DNA sequencing was carried out in Nepal Academy of Science and Technology (NAST) under DNA Barcoding Program funded by National Trust for Nature Conservation (NTNC).
Competing interests: The authors declare no competing interests.
Authors
details: Ram
Chandra Kandel has served
in protected areas of Nepal for 22 years and currently acting as joint
secretary in Ministry of Forests and Environment, Department of National Parks
and Wildlife Conservation. He has published dozens of papers in the national
and international journals and few book chapters on habitat ecology, mega-fauna
and animal behavior. Ram Chandra Poudel is interested in conservation genetics and phylogeography of threatened flora and fauna native to
Himalaya region. He is actively involved in creating DNA reference library of
endangered species naturally distributed in Nepal Himalaya. He has published on
conservation genetics, traditional use and community management of Himalayan
plants. Amir
Sadaula is Wildlife Veterinarian working in
National Trust for Nature Conservation-Biodiversity Conservation Center in Sauraha Chitwan. He is interested in molecular research
focused on phylogentic study of wildlife and wildlife
disease surveillance. He had major role in rescue and major translocation of
wildlife across Nepal. Prakriti
Kandel has keen interest in the field of molecular biology as well as
Wildlife Conservation. She carried out a research on assessment of the
glucocorticoid hormones in Asiatic Elephants Elephas maximus of Nepal.
She is determined to conserve the endangered animals through using latest
molecular tools. Kamal
Prasad Gairhe was stationed in Chitwan
National Park as Wildlife veterinarian for more than 25 years. He contributed
to several wildlife translocations and genetic studies; captive elephant
health, breeding, and diseases (Tuberculosis and EEHV). He has played a key
role to attract young researchers on wildlife health issues. Chiranjibi Prasad Pokheral
is a wildlife biologist, currently working as the Chief of the NTNC-Central
Zoo, Nepal. He has over two decade-long field experience and his research
interest includes the human wildlife conflict, interaction with predator-prey
relation, wildlife habitats and the conservation biology of large carnivores. Siddhartha
Bajra Bajracharya is associated with the
National Trust for Nature Conservation since 1989. At present, he is the
Executive Director (Programme) of NTNC. He made a
substantial contribution in development and management of Annapurna Conservation
Area Project of NTNC. His specialized fields of expertise are community based
conservation, ecotourism, protected area management and sustainable
development. Mukesh Kumar Chalise has specialized on feeding ecology and behavior of
Hanuman Langurs. He is extensively involved in biodiversity researches
especially on mammals and on their ecology and behavior. He supervises MSc and
PhD researchers and has published more than 75 international and national
scientific papers and books on wildlife species. Ghan Shyam Solanki focuses his research on ecology of
wildlife species, conservation biology of primates, butterflies, lizards in
particular and biodiversity conservation in general. He is also addressing all theses aspects in his teaching. He has published more than
hundred research papers in national and international journals and supervises
many PhD students.
Author contribution: RCK, RCP, MKC
and GSS conceived the research idea. RCK, AS, PK, CPP and SBB collected field
samples. RCP and AS performed DNA extraction, PCR, Sequencing and data
analyses. All the authors contributed equally in preparing the manuscript.
Acknowledgements: We are grateful to the Ministry of Forests and
Environment and the Department of National Parks and Wildlife Conservation for
issuing research permits to collect samples and do fieldwork in KTWR. Field work for blood and faecal sample
collection and molecular work were supported by the Hariyo
Ban Program of World Wildlife Fund, Nepal and National Trust for Nature
Conservation, Nepal, respectively. We
are thankful to staffs of Koshi Tappu
Wildlife Reserve (KTWR), Department of National Parks and Wildlife Reserve, and
the local people for their cooperation in sample collection and research visits
in KTWR. We express our sincere thanks
to Prof. J. Stuart F. Barker, University of New
England, Australia and Prof. Joel T. Heinen, Florida
International University, USA for their keen interest on the characterization
and conservation of Wild Buffalos of Nepal..
We express our thanks to Dr. Jyoti Maharjan, Dr. Deegendra
Khadka, and Mr. Mitesh Shrestha of NAST for their help in PCR and DNA
sequencing of buffalo samples. Lastly,
but not least, we show appreciation and express gratitude to three unknown
reviewers for their constructive comments and precious inputs, which helped to
improve this manuscript substantially.
Abstract: Koshi Tappu Wildlife Reserve (KTWR) has the last remaining
Nepalese population of the Endangered Asiatic Wild Buffalo (Bubalus
arnee Kerr, 1792). Individual animals protected inside KTWR may
be of purely wild, domestic or hybrid origin, and the wild population is under
potential threat due to habitat loss and genetic introgression
from feral backcrosses. Identification
of genetically pure wild individuals is important for identifying animals for
translocation to other areas within their former range. In this study we have sequenced a highly
variable 422bp region of the Cytochrome b gene of 36 animals, and added 61
published sequences of both River and Swamp Buffalo from Italy and some
southern Asian countries including India.
The haplotype diversities ranged from 0.286-0.589 with slightly higher
diversities in domesticated individuals.
The AMOVA analysis revealed that 97.217% of the genetic variation was
contained within groups and 2.782% occurred among groups. An overall fixation index (FST)
was found to be 0.02782 (p>0.05).
Phylogenetic relationships derived through a reduced median network and
maximum parsimony analyses reconfirmed the ancestral nature of the Wild Water
Buffalo. Moreover, this study has
reviewed recent achievements of molecular research in wild buffalo, assessed
the technical capacities of research institutes in Nepal to conduct molecular
research required for identifying pure wild individual in KTWR and more
importantly initiated DNA bank and DNA sequence library of buffalos, which will
enable an international collaboration for advanced molecular research in the
future.
Keywords: Asian Wild Buffalo, conservation, Cytochrome b, phylogenetics.
Introduction
The domesticated Water Buffalo Bubalus
bubalis Kerr, 1792 is one of the most important
dairy and draft animals in southern Asia.
Buffaloes are broadly categorized into two general ‘breeds’ sometimes
characterized as subspecies: river (Bubalus
bubalis bubalis) and
swamp buffalo (Bubalis bubalis
carabanesis).
Despite having distinct morphological and behavioural traits and
different karyotypes between these two categories of buffalo, they interbreed
easily and produce progeny with intermediate chromosomes (Mishra et al.
2015). Swamp and river buffalo have
different purposes and are found in different geographical areas. The swamp type, with wide-spreading horns and
some white markings, is more similar to Wild Buffalo Bubalus
arnee (Kumar et al. 2007; Mishra et al. 2015).
The Government of
Nepal (GoN) established Koshi
Tappu Wildlife Reserve (KTWR), an IUCN Category IV
protected area (Heinen 1995), in 1976 primarily to conserve the last Nepalese
population of Wild Buffalo (Heinen 1993).
Wild Buffalo cohabit the reserve with highly backcrossed feral buffalo
thought to have been released in the area in the 1950s (Dahmer 1978). Wild Water Buffalo Bubalus
arnee (Kerr, 1792) is considered Endangered
globally (Kaul et al. 2019), with isolated populations in KTWR and selected
areas of Bhutan, India, Thailand and possibly Myanmar and Cambodia
(Groves 1996; Heinen & Srikosamatara 2003;
Choudhury & Barker 2014). In 2016,
433 Wild Buffaloes were counted in KTWR (2016).
Despite the
possibility of interbreeding between wild and domesticated buffalo, it is
important to assign extant individuals to wild and other types where possible
to broaden our understanding of the genetic structure of different types and to
maintain genetic fingerprinting of wild breeds for their conservation. The introgression
from domestic to wild population is female-mediated, therefore mitochondrial
DNA (mtDNA) sequencing is likely to be helpful in the
identification of group-specific mitotypes.
The presence of wild-specific or domestic-specific haplotypes in either
group would allow us to identify hybrids (Lau et al. 1998; Flamand
et al. 2003). Furthermore, mtDNA sequence variations have been widely applied in
mammals to study inter- and intra- species phylogenetic relationships (Kikkawa et al. 1997; Lau et al. 1998; Conroy & Cook
1999; Kuwayama & Ozawa 2000; Kumar et al. 2007).
Conservation
decisions on translocation should be based on putative wild, feral and domestic
genetic assignments reliably performed through standard and widely accepted
techniques. Therefore, selecting
individuals for translocation programs, identification of wild individuals
through detailed molecular study of the buffalo population protected in the
reserve is a high priority for the Nepal government. In addition, understanding the genetic makeup
of Wild Buffalo could be used as the basis for genetic improvement of domestic
stock. National capacity building to
conduct advanced molecular studies should be initiated from collecting blood
and faecal samples, creating a DNA reference library and carrying out genetic
research on various aspects such as population genetics, breeding behaviours
among different buffalo types, disease dynamics, and food habits of buffalo
population in the reserve. We present
results of DNA sequence variation in the partial but variable cytochrome b gene
among purely wild, feral and domesticated individuals and future prospects for
advancing genetic research on Wild Buffaloes inhabiting KTWR in eastern Nepal.
Material
and Methods
Identification of
organizations
Nepal Government, Ministry of Forest and
Environment is working together with local communities and national and
international conservation partners to protect wild animals and restore their
natural habitats. With the aim of
establishing viable populations of endangered species in different areas and
safeguarding them from poaching and natural calamities such as flood, fire and
epidemics, the Ministry of Forests and Environment, Department of National
Parks and Wildlife Reserve (DNPWC) has been regularly translocating species to their
original natural habitats, viz.: One-horned Rhinoceros and Wild Water
Buffalo. In 2016, 18 individuals of Wild
Water Buffaloes were translocated from Koshi Tappu Wildlife Reserve (KTWR) to Chitwan National
Park. Translocation was carried out by a
team of 60 people including three veterinarians and 12 wildlife technicians led
by DNPWC with support from the World Wildlife Fund Nepal, the USAID-supported Hariyo Ban Program, National Trust for Nature Conservation,
Biodiversity Conservation Centre (NTNC-BCC), and the Zoological Society of
London (Nepal). A series of consistent
identification criteria that are based on phenotypic and behavioural
characteristics were used to choose Wild Buffaloes from different herds for
translocation. Given the availability of
highly polymorphic genetic markers, the expert team strongly recommended to
adopt genetic translocation as an effective and reliable management
strategy. For this management strategy
to be implemented effectively the team further emphasized the need for
institutional strengthening and capacity building of national laboratories to
conduct genetic research on buffalo before translocating them from the reserve
in future. Wildlife veterinarians,
biologists and research scholars from DNPWC and NTNC-BCC collected blood and
faecal samples of buffaloes and initiated a genetic study in the wildlife
laboratory of NTNC-BCC and molecular biotechnology laboratory of the Nepal
Academy of Science and Technology.
Sampling and blood
collection
A total of 42 blood
and faecal samples (Table 1) were collected mainly from individuals residing in
and around KTWR located in the Terai of southeastern Nepal (Figure 1). Animals were provisionally divided into three
classes: domestic (D, n=11), hybrid (H, n=11), and wild (W, n=20) based on the
consistent phenotypic and behavioural criteria (Dahmer 1978; Heinen & Paudel 2015) and location of herds sampling (domestic
buffalo were sampled from the villages nearby KTWR while wild and feral were
sampled using a location map of natal herds prepared by the reserve) and
behavioural and anatomical phenotypic traits.
All animals classified as domestic were river type buffalo with black
bodies and curled horns (as in the Murrah breed of
river buffalo), while those classified as wild had white chevrons, socks and
tail tips, and larger, relatively straight, pale-coloured horns (Image 1)
similar to swamp buffalos (Heinen 2002).
Hybrid animals had intermediate phenotypes and may be first generation
crosses or the result of various levels of backcrossing to either wild or
domestic.
DNA
Extraction, Polymerase Chain Reaction and
Sequencing
Genomic DNA was
extracted from blood using a Qiagen DNEasy Blood kit,
according to the manufacturer’s protocol.
For the faecal samples, a Qiagen QIAMP DNA Stool Mini Kit was used
following the manufacturer’s instructions.
Extracted DNA samples were stored at 4°C until they were used for
molecular analyses. Aliquots of
extracted DNA were used for PCR and sequencing.
The mitochondrial partial Cytochrome b gene of 422bp was amplified using primer pairs (L14724: 5’-
CGAAGCTTGATATGAAAAACCATCGTTG-3’ and H15149: 5’-
AAACTGCAGCCCCTCAGAATGATATTTGTCCTCA -3’) (Kocher et al. 1989). PCR was carried out with 3µl template DNA,
15µl of Hot Start Taq 2X Mastermix
(New England Biolab, UK), 1µl of each primer and 7µl of nuclease free water in
a total reaction volume of 30µl using an ABI VeritiTM
Thermal Cycler (Model no. 9902). Of the
42 samples, only 36 were amplified
successfully and rest of the six didn’t amplify even in multiple attempts due
to poor DNA quality. The PCR conditions
were an initial denaturation at 94°C for 10 minutes, followed by 35 cycles of
denaturation at 94°C for 30s, annealing at 55°C for 30s, elongation at 72°C for
45s and a final extension at 72°C for 10 minutes. The PCR products were electrophoresed at 100
volts for 30 minutes in 1.5% agarose gels, viewed in Gel Doc (Syngene InGenius) after staining
with Sybr safe and photographed.
Amplified DNA
fragments were purified using ExoSap-IT Express PCR
Product Clean up (Affymetrix Inc., Santa Clara, CA, USA) following a cycle of
37°C for 15 minutes and 80°C for 1 minute in a thermo-cycler. High quality purified PCR amplicons were
subjected to Dideoxy sequencing in a total volume of 10µl containing 1µl
purified PCR product, 1µl Big Dye terminator sequencing mixture (V3.1) (BIGDYE
Terminator Cycle Sequencing Kit, Applied Biosystems, Foster, CA, USA), 1.5µl
sequencing buffer and 1.5µl primer (10µm).
Sequencing was done at Nepal Academy of Science and Technology,
Molecular Biotechnology Laboratory, in an ABI 3500XL automated DNA sequencer
(Applied Bio-systems, Forster City, CA, USA).
Sequencing for the majority samples was performed for one time but in
the case sequence quality was low and/or polymorphism was observed then
re-sequencing was done for confirmation.
Successful sequences of 36 samples were deposited in GenBank (Accession
no. MH718851–85)
Sequence alignment,
haplotype identification and phylogeny
Raw sequence
fragments were assembled, checked and edited with Sequencer 5.0 (Gene Codes
Corp., Ann Arbor, MI, USA) and contigs of both
reverse and forward primers were created.
Sequences were aligned with ClustalX (Thompson
et al. 1997) in BioEdit. In addition to our 36 sequences (W=15, H=10
and D=11 ), we included the 42 Nepalese samples (W=7, H=15 and D=20 ) of Flamand et al. (2003), sequenced and analysed by Zhang et
al. (2016, KR009944-85), four Cytochrome b haplotypes from Indian river buffalo
identified by Kumar et al. (2007, EF409939 H1-4) and 15 Cytochrome b haplotypes
defined by Kikkawa et al. (1997), eight river buffalo
from Bangladesh, Sri Lanka, Italy and Pakistan and seven swamp buffalo from
Japan, Taiwan, Thailand, Philippines, Indonesia and Bangladesh (D34637–38,
D88627–38, D88983).
All sequences were
aligned and mitochondrial haplotypes were defined in DnaSP
v5, and haplotype (h) and nucleotide diversity (π) were estimated using DnaSP v5 (Librado & Rozas 2009). Genetic
differentiation within and between buffalo groups (wild, hybrid and domestic)
was estimated by an analysis of molecular variance (AMOVA) using 10,000
permutations in Arlequin v3.5 (Excoffier & Lischer 2010).
Similarly, pairwise genetic divergences between groups (FST)
was also calculated and significances tested using 10,000 permutations in
Arlequin v3.5.
Phylogenetic
relationships among haplotypes were derived through a reduced median network
v4.6 (Bandelt et al. 1999). To identify phylogenetic lineages, maximum
parsimony (MP) analysis was performed in PAUP 4.0b10 (Swofford 2002) using the
heuristic search option with 1,000 random additions and the tree
bisection-reconnection (TBR) swapping and the MULTrees
option on. Branch support was provided
by a bootstrap analysis of 10,000 replicates of heuristic searches, with the MULTrees option on and TBR swapping off. Consistency indices (CI) and retention
indices (RI) were obtained in PAUP. In
addition, a neighbor-joining (NJ) tree (Saitou & Nei 1987) was produced using MEGA7 (Kumar et al. 2016).
Results
Sequence Variation
and Divergence
The lengths of the
36 partial cytochrome b sequences including primers at both ends for all the
three types of buffalo were 486bp. When
primers on either end were removed the sequence lengths were 422bp. The aligned matrix without primers contained
two variable sites (Table 2), however, when our data set was compared with the
accession data of Zhang et al. (2016), Kumar et al. (2007), and Kikkawa et al. (1997), base substitutions at 13 nucleotide
positions (variable sites) were obtained and, among them, three nucleotide
positions were specific for river buffalo and 10 positions were specific for
swamp buffalo. The sequence divergence
within buffalo of Nepal and India was 0.24 to 0.49 %; however, when compared
with river buffalo sequence of Kikkawa et al. (1997),
the divergence was slightly higher: 0.24 to 0.74 %. Sequence divergence within swamp buffalo was
0.24 to 0.98%. The sequence divergence
between swamp and river buffalo was calculated to be 1.49 to 2.49%.
Haplotype
Identification, Differentiations, and Phylogenetic relations
The 97 partial
cytochrome b sequences, including 36 from this study, showed a total of 13
variable sites (Table 2, see Figure 2), which defined nine haplotypes. Nepalese buffalo had either haplotype H1, H2
or H3, but the three classes domestic (D), hybrid (H) and wild (W) were
represented among both H1 and H2 (H1: D=23,W=18, H=17; H2: H=8, D=7, W=2 and
H3: W=2). The most common haplotype (H2)
was widely distributed among groups and represented by 66% of sequences (Nepal:
D=23, W=18 and H=17; one of Kumar et al. (2007); and five of Kikkawa et al. (1997).
The second most common haplotype (H1) was represented by 20% of the
samples (H=8, D=7, and W=2) and one each from Kumar et al. (2007) and Kikkawa et al. (1997).
Three sequences of Nepalese samples, two from this study and one each
from Zhang et al. (2016) and Kumar et al. (2007) were restricted to the third
haplotype (H3). Of the remaining six
haplotypes, one was reported by Kumar et al. (2007; H4) while the remaining
five (H5 to H9) were defined by Kikkawa et al.
(1997). Haplotypes 4, 6 and 7 were found
in river animals from other countries (i.e., not Nepal) and haplotypes 5, 8 and
9 were specific to swamp buffalo.
Within groups, haplotype diversity was highest in
hybrids followed by domesticated buffalo, and slightly lower in Wild Buffalo
(Table 3). Overall haplotype and
nucleotide diversities were 0.403 and 0.00105, respectively. Haplotypes were
divided into two branches corresponding to river and swamp buffalo by six
nucleotide mutations. River buffalo were found to be less diverse genetically
than swamp buffalo. The AMOVA conducted
for 78 Nepalese buffaloes under three groups showed highest variation (97.21%)
partitioned within groups and very little variation (2.782%) partitioned among
them with an overall fixation index FST of 0.0278 (p > 0.05)
(Table 4). The pairwise genetic
variations between groups also revealed non-significant low FST
scores (wild vs hybrid, FST - 0.055, p = 0.126; wild vs domestic, FST
- 0.002, p = 0.416 and hybrid vs domestic, FST -
0.020, p = 0.546). The maximum
parsimony analysis of the 97 sequences revealed four distinct clades (clades A
through D) with moderate to high bootstrap values (Figure 3). The three most parsimonious trees (CI = 1.00,
RI = 1.00, length = 15 steps) were recovered.
Clade A contained all H1 sequences plus one H4 and one H6, Clade B
contained all 19 H2 sequences plus one H7,
Clade C contained all four sequences of Haplotype H3 and Clade D, with a
high bootstrap value (99%), included all swamp animals (Haplotypes H5, H8,
H9). The strong separation of swamp and
river buffalo is also shown by the median joining network, with six mutations
separating H8 and H2. Neighbour-joining
(NJ) phylogenetic analysis showed the same topology (Supporting information,
Appendix 1).
Discussion
Conservation status of Wild Buffalo population in Nepal
Nepal is home to a population of the Endangered Asiatic Wild Buffalo Bubalus arnee, the
progenitor of domesticated water buffalo (Lei et al. 2007). Recent censuses of Wild Buffalo in KTWR
revealed that the population increased to 433 individuals (KTWR 2016), an
increase of 105 individuals compared to 2014 (Khatri et al. 2013 ). There were only 63 individuals at the time of establishment of KTWR
in 1976 (Dahmer
1978). The historic range of this
species extended further west within Nepal, and at least as far as Chitwan
National Park, however, Wild Buffalo have been restricted to KTWR for an
estimated 60 years and they are under constant threat of extirpation from
floods, habitat deterioration, hybridization, and the potential for diseases
and parasites transmitted by domestic livestock (Heinen & Kandel
2006). Since Wild Buffalo have been
eliminated from the greater part of their former range, the Nepalese population
is very important for the survival of the species globally (Beyers et al. 1995;
Hedges 1995, 2001; Choudhury & Barker 2014).
Given the
precarious existence of Wild Buffalo within KTWR, several wildlife
conservationists have emphasized the need to translocate a sufficient number of
individuals to sites within their indigenous range. Chitwan National Park had this species at
least until the 1950s (Spillet & Tamang 1966; Aryal et al. 2011) and has extensive grassland areas, and
much larger riverine habitats with sufficient upland areas that are not prone
to flooding, compared to KTWR (Heinen & Paudel
2015). For these reasons 18 Wild
Buffaloes were translocated to Chitwan National Park from KTWR recently, and
more need to be moved in the near future (Shah et al. 2017; Kandel et al.
2018).
Identification of
wild individuals in KTWR
Translocation of
endangered species can restore species, protect populations from threats and
reinstate the local ecosystem functions (Tarszisz et
al. 2014). Adequate morphological and
genetic studies should be carried out to distinguish putative wild from feral
backcrossed animals for translocation programs.
During translocation enough purely wild individuals must be moved to assure
genetic variation in the founding population.
Although the recent selection of individuals for translocation to
Chitwan was based on phenotypic and behavioural characteristics widely
recommended by Dahmer (1978), many individuals of mixed wild-domestic ancestry
may not be correctly distinguished from wild animals (Flamand
et al. 2003).
On the basis of the
partial cytochrome b sequences, we were able to define only three haplotypes in
Nepalese buffalo. None of the haplotypes
were specific to wild, domestic and hybrid types identified here. These haplotypes had been identified by Zhang
et al. (2007, 2016), Kumar et al. (2007), and Kikkawa
et al. (1997) in their Nepalese, Indian, and wider samples (Pakistan,
Bangladesh, Thailand and Sri Lanka).
Although we have used the partial sequence of cytochrome b gene, the
complete length (1,120bp) of this gene sequence reported from other studies (Kikkawa et al. 1997; Kumar et al. 2007) including 42
Nepalese samples from Zhang et al. (2016) did not show consistent distinctions
between wild, hybrid, and domestic group of buffalos. Non-significant genetic variability observed
between three groups of buffaloes and the highest, i.e., 97.21% total
variations found within group in AMOVA analysis, clearly shows an evidence of
gene flow between groups. In KTWR, most
of the time wild, feral and domestic herds share grazing areas, where
crossbreeding between groups occurs frequently.
Moreover, low genetic variation between groups is also attributed to
local the farmers’ practice of crossbreeding domestic females with wild males
(Heinen 2001).
NJ and MP analysis
performed (results not shown) with the complete length (1,120bp) cytochrome b
sequences of Zhang et al. (2016, 42 Nepalese sequences), Kumar et al. (2007,
four river buffalo haplotypes), and Kikkawa et al.
(1997, seven river and eight swamp haplotypes) provided essentially the same
topography of the tree but an addition of one more haplotype represented by Genbank accession KR009945NP_D07 alone.
Lau et al. (1998)
using partial cytochrome b sequence (303bp) and D-loop (158bp) sequence
suggested that Wild Asian Water Buffalo (Bubulus
arnee) in Assam, Nepal and Indo-China is the
possible ancestor of both river and swamp buffalo. The study by Tanaka et al. (1996) also
supports this hypothesis. Nepal’s Wild Buffalo
show swamp type phenotypic characteristics but Zhang et al. (2011) found them
genetically closer to river buffalo. Our
study is consistent with Zhang et al. (2011) in that our MP, NJ and Network
analyses of swamp buffalo showed distinct variation with a bootstrap value of
almost 100% and six nucleotide differences between these groups. Similar results were obtained by Mishra et
al. (2015) in upper Assamese and Chilika populations
of domestic buffalo, which show phenotypic similarities to swamp buffalo but
are also genetically closer to wild-type buffalo in the region. Our multi-lineage MP and NJ trees and several
previous studies (Tanaka et al. 1996; Lau et al. 1998; Zhang et al. 2011, 2016;
Mishra et al. 2015) inferred the ancestral nature of Wild Water Buffalo
including the remnant population in Nepal.
In this context, to determine genetically pure wild individuals in KTWR
detailed and advanced genetic research is necessary.
National capacity
building and close collaborations for genetic translocation
Phylogenetic
analysis of partial cytochrome b region revealed overlapping clusters of wild,
feral and domestic buffalo types residing in KTWR. The findings of this study along with
previous genetic studies on water buffalo populations distributed globally
including Wild Buffaloes of KTWR suggest that, single marker or partially
overlapping markers are not sufficient to show the level of admixture and introgression of domestic in wild stock at the local
level. Genome level assessments of
source population offfers specific criteria and
objective means for translocation of an appropriate group of buffalos. Over the past several years thousands of
Single Nucleotide Polymorphisms (SNPs) have been identified in wild and farm
animals (Ciani et al. 2014; Decker et al. 2014; Edea et al. 2014) including river and swamp buffalo (Imartino et al. 2017; Colli et
al. 2018). Axiom® Buffalo
Genotyping Array that includes about 90K SNP loci covering the water buffalo
genome-wide was developed in collaboration with the International Buffalo
Genome Consortium. This 90K “SNP-Chip” was tested in several river
buffalo populations throughout its distribution and found to have about 70%
high quality and polymorphic SNPs (Iamartino et al.
2017). This chip provides tremendous
opportunity for genome wide investigation of genetic diversity and population
structure in wild and feral buffalos, their genetic mapping and quantification
of the level of domestic introgression into wild
happening in different herds of KTWR.
This ability will further help to select genetically pure wild
individuals for a translocation. Few
studies have proposed translocation protocols focusing on how many and what
individuals should be selected representing different herds of putative wild
stock or feral backcrossed (Heinen 2002; Heinen & Kandel 2006; Heinen &
Paudel 2015) buffalo in KTWR. Before planning a translocation of buffaloes,
the current protocol should be revised thoroughly to decide on the selection of
an adequate number of appropriate individuals from each herd and for SNP
genotyping throughout the whole genome of those selected individual buffaloes.
Sufficient genetic
diversity of wild individuals or feral backcrossed as suggested by Heinen &
Paudel (2015) should be represented from a source
population of KTWR to the translocated population in the native area such as
Chitwan, Bardiya or other appropriate sites (Heinen
2002) in Nepal. Founding genetic
diversity of translocated population will be determined by the number of
genetically variable wild individuals, the proportion of diverse pure stocks,
those that contribute genetically to the next generation and number and
frequency of polymorphic alleles that represent whole genomes of the source
population. Translocated populations are
mostly small in size therefore they are prone to loss of genetic diversity very
rapidly through genetic drift (Frankham et al. 2012).
Genetic assessment of source populations in advance of translocation
(pre-translocation) helps to guide translocation plans and inform post
translocation assessment or monitoring of genetic diversity in the founders (Groombridge et al. 2012).
In addition to geneticists, active involvement of conservation
biologists, wildlife experts, wildlife veterinarians, ecologists, physiologists
and local people in the translocation program can ensure longer-term welfare
and wellbeing of the re-introduced population.
Before embarking on
a genetic translocation program for the buffalo of KTWR, Nepal should upscale
its laboratory facilities, design population-based advanced genetic research
and take the initiative to build a DNA bank of all possible individuals counted
in 2016. The DNA bank, reference DNA
sequences and genotype database are crucial for research and conservation
efforts, to enhance our understanding of genetic effects of introgression,
the study of dietary patterns on different buffalo types and assess the status
of pathogens affecting the buffaloes with different genetic backgrounds. Using the same blood samples collected during
this study we have reported the prevalence of malaria parasites for the first
time in buffaloes of KTWR (Kandel et al. 2019).
Given the lack of highly technical laboratories and trained manpower in
Nepal and the urgency to identify wild individuals reliably, collaborative
research with international universities, research institutes and conservation
partners on advanced molecular studies are to be jointly conducted. In conclusion this research sets a baseline to
develop well defined action-oriented strategies that guide pre-translocation
genetic study of wild buffaloes in KTWR and their monitoring through
post-translocation genetic studies. Key
actions highlighted in this paper such as collaboration between partners,
establishment of DNA bank of all extant individuals in KTWR, involve experts
from different disciplines, upscale and strengthen present laboratories and
build capacity of available human resources for genomic level data management
are important steps to be taken by the Ministry of Forest and Environment,
Department of National Parks and Wildlife Conservation and its national and
international conservation partners for genetic translocation of Wild Buffalo
including other threatened species of Nepal.
Table 1. Sample code, classification and individual
details of Wild Buffalo Bubalus arnee sampled from Koshi Tappu Wildlife Reserve, Nepal. Blood samples were taken
from individuals if not mentioned in sample type.
|
Samples
code |
Group |
Sex,
age, date of collection |
Sample
type |
|
BuffH1 |
Hybrid |
Female, 10
month, 02.vii.2017 |
|
|
BuffH2 |
Hybrid |
Female, 6
years, 29.vi.2017 |
|
|
BuffH3 |
Hybrid |
Female, 2
years, 29.vi.2017 |
|
|
BuffH4 |
Hybrid |
Female, 2
years, 02.vii.2017 |
|
|
BuffH5 |
Hybrid |
Male, 2
years, 02.vii.2017 |
|
|
BuffH6 |
Hybrid |
Male, 2
years, 02.vii.2017 |
|
|
BuffH7 |
Hybrid |
Male, 2
years, 29.vi.2017 |
|
|
BuffH8 |
Hybrid |
Female, 2
years, 29.vi.2017 |
|
|
BuffH9 |
Hybrid |
Male, 10
month, 02.vii.2017 |
|
|
BuffH10 |
Hybrid |
Male, 1.5
years, 02.vii.2017 |
|
|
BuffH11 |
Hybrid |
Female, 8
month, 02.vii.2017 |
|
|
BuffD12 |
Domestic |
Female, 1.5
years, 02.vii.2017 |
|
|
BuffD13 |
Domestic |
Female,
Adult , 27.vi.2017 |
|
|
BuffD14 |
Domestic |
Female, 10
years, 27.vi.2017 |
|
|
BuffD15 |
Domestic |
Male, 2
years, 01.vii.2017 |
|
|
BuffD16 |
Domestic |
Male, 2
years, 01.vii.2017 |
|
|
BuffD17 |
Domestic |
Male, 1
years, 01.vii.2017 |
|
|
BuffD18 |
Domestic |
Female, 12
years, 01.vii.2017 |
|
|
BuffD19 |
Domestic |
Male, 1
year, 29.vi.2017 |
|
|
BuffD20 |
Domestic |
Male, 1
year, 29.vi.2017 |
|
|
BuffD21 |
Domestic |
Male, 2.5
years, 27.vi.2017 |
|
|
BuffD22 |
Domestic |
Female, 1
year, 01.vii.2017 |
|
|
BuffW23 |
Wild* |
Male,
Adult, 04.ii.2017 |
|
|
BuffW24 |
Wild* |
Male,
Adult, 26.i.2017 |
|
|
BuffW25 |
Wild* |
Female,
Sub-adult, 06.ii.2017 |
|
|
BuffW26 |
Wild* |
Female,
Adult, 01.ii.2017 |
|
|
BuffW27 |
Wild |
Male, Adult
|
Fecal
Sample |
|
BuffW28 |
Wild** |
Male,
Adult, 05.ii.2017 |
|
|
BuffW29 |
Wild** |
Female,
Adult, 01.ii.2017 |
|
|
BuffW30 |
Wild** |
Female,
Adult, 01.ii.2017 |
|
|
BuffW31 |
Wild** |
Female,
Adult, 06.ii.2017 |
|
|
BuffW32 |
Wild** |
Female,
Adult, 05.i.2017 |
|
|
BuffW33 |
Wild** |
Female/2.5
years, 06.i.2017 |
|
|
BuffW34 |
Wild |
Female,
Adult |
Fecal
sample |
|
BuffW35 |
Wild |
Male, Adult
|
Fecal
Sample |
|
BuffW36 |
Wild |
Male, Adult
|
Fecal
sample |
|
BuffW37 |
Wild |
Female,
Adult |
Fecal
Sample |
|
BuffW38 |
Wild* |
Female,
Adult, 31.i.2017 |
|
|
BuffW39 |
Wild* |
Female,
Adult, 29.i.2017 |
|
|
BuffW40 |
Wild* |
Female,
Adult, 27.i.2017 |
|
|
BuffW41 |
Wild |
Male, Adult
|
Fecal
sample |
|
BuffW42 |
Wild |
Male, Adult
|
Fecal
sample |
*—Translocated from KTWR | **—Collected from Central
Zoo, Lalitpur | Wild—20 | Hybrid—11 | Domestic—11.
Table 2. Variable nucleotide positions for the partial
Cytochrome b gene of the 36 accessions of the present study, 42 accessions of
Zhang et al. (2016), four accessions of Kumar et al. (2007), and 15 accessions
of Kikkawa et al. (1997).
|
Haplotypes |
Nucleotide
positions |
Frequency |
Remarks |
||||||||||||
|
30 |
61 |
79 |
81 |
87 |
99 |
147 |
234 |
240 |
375 |
379 |
411 |
417 |
|||
|
H1 |
T |
C |
G |
T |
T |
C |
T |
A |
G |
T |
T |
A |
A |
64 |
Nepal
sample, Kikkawa et al. (1997), Kumar et al. (2007),
Zhang et al. (2016) |
|
H2 |
T |
C |
G |
T |
T |
T |
T |
A |
G |
T |
T |
A |
A |
19 |
As above |
|
H3 |
T |
C |
G |
T |
T |
C |
T |
A |
C |
T |
T |
A |
A |
4 |
As above |
|
H4 |
T |
C |
G |
T |
T |
C |
T |
A |
A |
T |
T |
A |
A |
1 |
Kumar et
al. (2007) |
|
H5 |
C |
C |
G |
C |
T |
C |
C |
G |
G |
C |
C |
A |
G |
2 |
Kikkawa et
al. (1997) |
|
H6 |
T |
C |
G |
T |
T |
C |
T |
A |
G |
T |
T |
A |
T |
1 |
As above |
|
H7 |
T |
C |
A |
T |
T |
T |
T |
A |
G |
T |
T |
A |
A |
1 |
As above |
|
H8 |
C |
C |
G |
C |
T |
C |
C |
G |
G |
C |
C |
A |
A |
4 |
As above |
|
H9 |
C |
G |
G |
C |
A |
C |
C |
G |
G |
C |
C |
G |
A |
1 |
As above |
|
Total |
97 |
|
|||||||||||||
Table 3.
Haplotype diversity (h) and nucleotide diversity (π) estimated from partial
mitochondrial Cytochrome b sequences of 78 Nepalese buffalo of three different
groups (wild, domesticated, and hybrid).
|
Buffalo |
No.
of haplotypes (H) |
Sample
size |
h
(Haplotype diversity) |
SD |
π
(nucleotide diversity) |
SD |
|
|
Wild |
This
study |
3 |
15 |
0.362 |
0.145 |
0.00095 |
0.00041 |
|
|
Zhang
et al. 2016 |
2 |
7 |
0.286 |
0.196 |
0.00071 |
0.00049 |
|
|
Total |
3 |
22 |
0.329 |
0.121 |
0.00086 |
0.00034 |
|
Hybrid |
This
study |
2 |
10 |
0.467 |
0.132 |
0.000116 |
0.00033 |
|
|
Zhang
et al. 2016 |
2 |
15 |
0.476 |
0.092 |
0.00119 |
0.00023 |
|
|
Total |
2 |
25 |
0.453 |
0.072 |
0.00113 |
0.00018 |
|
Domesticated |
This
study |
2 |
11 |
0.509 |
0.101 |
0.00127 |
0.00025 |
|
|
Zhang
et al. 2016 |
3 |
20 |
0.353 |
0.123 |
0.00092 |
0.00034 |
|
|
Total |
3 |
31 |
0.411 |
0.087 |
0.00106 |
0.00024 |
|
All
this study |
|
3 |
36 |
0.438 |
0.082 |
0.00116 |
0.00024 |
|
All
Zhang et al. (2016) |
3 |
42 |
0.382 |
0.076 |
0.00098 |
0.00021 |
|
|
Total |
3 |
78 |
0.403 |
0.055 |
0.00105 |
0.00016 |
|
Table 4. Analysis of molecular variance (AMOVA) for
the three groups of buffaloes based on partial cytochrome b region.
|
Source of variation |
df |
Sum of squares |
Variance components |
Percentance of variation |
Fixation indices (FST) |
|
Among populations |
2 |
0.716 |
0.00590 |
2.78237 |
0.02782* |
|
Within populations |
75 |
15.463 |
0.20618 |
97.21763 |
*p > 0.05
For
image & figures - - click here
References
Aryal, A., T.K. Shrestha, A. Ram, W. Frey, C. Groves, H. Hemmer, M. Dhakal, R.K. Koirala, J.T. Heinen & D. Raubenheimer (2011). A call to save the wild water buffalo (Bubalus
arnee) in Nepal. International Journal of Conservation
Science 2(4):
261–268.
Bandelt, H.J., P. Forster
& A. Röhl (1999).
Median-joining networks for inferring intraspecific phylogenies. Molecular
Biology and Evolution 16(1): 37–48. https://doi.org/10.1093/oxfordjournals.molbev.a026036
Beyers, O., S.
Hedges & U.S. Seal (1995). Asian wild cattle conservation assessment and
management plan working document. IUCN/SSC Conservation Breeding Specialist
Group: Apple Valley, MN. 121pp.
Choudhury, A. &
J.S.F. Barker (2014). Wild Water Buffalo Bubalus arnee (Kerr, 1792), pp. 255–301 In: Melleti,
M. & J. Burton (eds). Ecology, Evolution and
Behaviour of Wild Cattle. Cambridge University Press, Cambridge, 512pp.
Ciani, E., P. Crepaldi, L. Nicoloso, E. Lasagna, F.M. Sarti, B. Moioli, F. Napolitano,
A. Carta, G. Usai,
M. D’Andrea,
D. Marletta, R. Ciampolini, V. Riggio,
M. Occidente,
D. Matassino,
D. Kompan,
P. Modesto, N. Macciotta, P. Ajmone-Marsan &
F. Pilla (2014). Genome wide
analysis of Italian sheep diversity reveals a strong geographic pattern and
cryptic relationships between breeds. Animal Genetics 45(2):
256–266. https://doi.org/10.1111/age.12106
Colli, L., M. Milanesi, E. Vajana, D. Iamartino, L. Bomba, F. Puglisi,
M.D. Corvo, E.L. Nicolazzi,
S.S.E. Ahmed, J.R.V. Herrera, L. Cruz, S. Zhang, A. Liang, G. Hua, L. Yang, X.
Hao, F. Zuo, S.J. Lai, S. Wang, R. Liu, Y. Gong, M. Mokhber, Y. Mao, F. Guan, A. Vlaic,
B. Vlaic, L. Ramunno, G.
Cosenza, A. Ahmad, I. Soysal, E.O. Ünal, M. Ketudat-Cairns, J.F.
Garcia, Y.T. Utsunomiya, P.S. Baruselli, M.E.J.
Amaral, R. Parnpai, M.G. Drummond, P. Galbusera, J. Burton, E. Hoal, Y.
Yusnizar, C. Sumantri, B. Moioli, A. Valentini, A. Stella,
J.L. Williams & P. Ajmone-Marsan (2018). New insights on
water buffalo genomic diversity and post-domestication migration routes from
medium density SNP chip data. Frontier in Genetics 9: 53. https://doi.org/10.3389/fgene.2018.00053
Conroy, C.J. &
J.A. Cook (1999). MtDNA evidence for repeated pulses of
speciation within arvicoline and murid rodents. Journal
of Mammalian Evolution 6(3): 221–245. http://doi.org/10.1023/A:1020561623890
Corbet, G.B. &
J.E. Hill (1992). Mammals of the Indomalayan Region. A
Systematic Review. Oxford University Press, Oxford, UK, 488pp.
Dahmer, T. (1978). Status and
Distribution of the Wild Buffalo (Bubalus bubalis) in Nepal. MS Thesis, University of Montana,
Missoula, Montana, USA, 120pp.
Decker, J.E., S.D.
McKay, M.M. Rolf, J.W. Kim, A.M. Alcalá, T. S. Sonstegard, O. Hanotte, A. Götherström, C.M. Seabury, L. Praharani,
M.E. Babar, L.C.A. Regitano, M.A. Yildiz,
M.P. Heaton, W.S. Liu, C.Z. Lei, J.M. Reecy, M. Saif-Ur-Rehman, R.D. Schnabel & J.F. Taylor (2014).
Worldwide patterns of ancestry, divergence, and admixture in domesticated
cattle. PLoS Genet. 10:e1004254.
https://doi.org/10.1371/journal.pgen.1004254
Edea, Z., S.W. Kim,
K.T. Lee, T.H. Kim & K.S. Kim (2014). Genetic Structure of and Evidence for
Admixture between Western and Korean Native Pig Breeds Revealed by Single
Nucleotide Polymorphisms. Asian-Australasian Journal of Animal Sciences 27(9):
1263–1269. https://doi.org/10.5713/ajas.2014.14096
Excoffier, L. & H.E.L. Lischer (2010). Arlequin Suite Ver 3.5: a new series of programs
to perform population genetics analyses under Linux and Windows. Molecular
Ecology Resources 10: 564–567. https://doi.org/10.1111/j.1755-0998.2010.02847.x
Flamand, J.R.B., D. Vankan, K.P. Gairhe, H. Duong
& J.S.F. Barker (2003). Genetic identification of wild Asian water buffalo in Nepal. Animal
Conservation 6(3): 265–270. https://doi.org/10.1017/S1367943003003329
Frankham, R., J.D. Ballou
& D.A. Briscoe (2012). Introduction to
conservation genetics. Cambridge University Press, UK, 618pp.
Groves, C.P. (1996). The taxonomy of the Asian
wild buffalo from the Asian mainland. International Journal of Mammalian
Biology 61: 327–338.
Hedges, S. (1995). Asian Wild Cattle and Buffalo: Draft Status Report and Conservation
Action Plan (Part I and II). Gland, Switzerland, 310pp.
Hedges, S. (2001). Asian Wild Cattle
Specialist Group Quadrennial Report. Gland Switzerland, 122pp.
Heinen, J.T.
(1993). Population
viability and management recommendations for wild water buffalo (Bubalus bubalis) in
Nepal. Biological Conservation 65(1): 29–34. https://doi.org/10.1016/0006-3207(93)90193-5
Heinen, J.T.
(1995). Nature
Preserves, pp. 551–561. In: Nierenberg,
W.A. (ed.). Encyclopedia of Environmental
Biology. Academic Press, San Diego, California, USA.
Heinen, J.T. (2001). A translocation
proposal for Wild Buffalo (Bubalus bubalis) in Nepal: recommended management action in the
face of uncertainty for a critically endangered species. Tiger Paper 28(3):
1–8.
Heinen, J.T. (2002).
Phenotypic and behavioural characteristics used to identify Wild Buffalo (Bubalus bubalis)
from feral backcrosses in Nepal. Journal of the Bombay Natural History
Society 99: 173–183.
Heinen, J.T. &
R.C. Kandel (2006). Threats to a small population:
A census and conservation action plan for wild buffalo in Nepal. Oryx
40(3): 324–330. https://doi.org/10.1017/S0030605306000755
Heinen, J.T. &
P. Paudel (2015). On the translocation of Asian buffalo Bubalus arnee in
Nepal: are feral backcrosses worth conserving? Conservation Science 3:
11–19.
Heinen, J.T. &
S. Shrikosamatara (1996). Status and
protection of Asian wild cattle and buffalo.
Conservation Biology 10(4): 931–934. https://doi.org/10.1046/j.1523-1739.1996.10040931.x
Iamartino, D., E.L. Nicolazzi, C.P. Van Tassell, J.M.
Reecy, E.R. Fritz-Waters, J.E. Koltes,
S. Biffani, T.S. Sonstegard,
S.G. Schroeder, P. Ajmone-Marsan, R. Negrini, R. Pasquariello, P. Ramelli, A. Coletta, J.F. Garcia, A. Ali, L. Ramunno, G. Cosenza & D.A.A. de Oliveira (2017). Design and
validation of a 90K SNP genotyping assay for the water buffalo (Bubalus bubalis). Plos ONE 12(10): e0185220. https://doi.org/10.1371/journal.pone.0185220
IUCN (2013). IUCN Red List
of Threatened Species. Version 2013.2. www.iucnredlist.org,
downloaded on 24 May, 2014
Kandel, R.C., G.S.
Solanki, M.K. Chalise & B.K. Sharma (2018). Population and
Demography of Asian Wild Buffalo (Bubalus arnee Kerr, 1792) at Koshi Tappu Wildlife Reserve, Nepal. Journal of Emerging
Trends in Economics and Management Sciences 9(4): 212–218.
Kandel, R.C., M.
Shrestha, A. Saduala, K.C. Medha,
J. Maharjan, G.S. Solanki, M.K. Chalise,
M. Asada, O. Kaneko, R.C. Poudel & K. Pandey (2019). First report of
malaria parasites in water buffalo in Nepal. Veterinary Parasitology:
Regional Studies and Reports 18: 100348. https://doi.org/10.1016/j.vprsr.2019.100348
Kaul, R., A.C.
Williams, K. Rithe, R. Steinmetz, & R. Mishra
(2019). Bubalus arnee. The
IUCN Red List of Threatened Species 2019:
e.T3129A46364616. https://doi.org/10.2305/IUCN.UK.2019-1.RLTS.T3129A46364616.en. Downloaded
on 10
November 2019.
Khatri, T.B., D.N.
Shah & N. Mishra (2012). Wild Water Buffalo Bubalus
arnee in Koshi Tappu Wildlife Reserve, Nepal: status, population and
conservation importance. Journal of
Threatened Taxa 4(14): 3294–3301. https://doi.org/10.11609/JoTT.o2990.3294-301
Kikkawa, Y., H. Yonekawa, H. Suzuki & T. Amano (1997). Analysis of genetic
diversity of domestic water buffalo and anoas based
on variations in the mitochondrial gene for cytochrome b. Animal Genetics
28(3): 195–201. https://doi.org/10.1111/j.1365-2052.1997.00101.x
Kocher, T.D., W.K.
Thomas, A. Meyer, S.V. Edwards, S. Paabo, F.X. Villablanca & A.C. Wilson (1989). Dynamics of
mitochondrial DNA evolution in animals: amplification and sequencing with
conserved primers. Proceeding of the National Academy of Science USA
86(16): 6196–6200. https://doi.org/10.1073/pnas.86.16.6196
KTWR (2016). Census of Asiatic
Water Buffalo (Bubalus arnee)
at Koshi Tappu Wildlife
Reserve: 2016. Department of National Parks and Wildlife Reserve and Koshi Tappu Wildlife Reserve
(KTWR), 78pp.
Kumar, S., M.
Nagarajan, J.S. Sandhu, N. Kumar, V. Behl & G.
Nishanth (2007). Mitochondrial DNA analyses of Indian water buffalo support a distinct
genetic origin of river and swamp buffalo. Animal Genetics 38(3):
227–232. https://doi.org/10.1111/j.1365-2052.2007.01602.x
Kumar, S., G. Stecher & K. Tamura (2016). MEGA7: Molecular Evolutionary
Genetics Analysis version 7.0 for bigger datasets. Molecular Biology and
Evolution 33(7): 1870–1874. https://doi.org/10.1093/molbev/msw054
Kuwayama, R. & T. Ozawa
(2000).
Phylogenetic relationships among European Red Deer, Wapiti, and Sika Deer inferred
from mitochondrial DNA sequences. Molecular
Phylogenetics and Evolution
15: 115–123. https://doi.org/10.1006/mpev.1999.0731
Lau, C.H., R.D.
Drinkwater, K. Yusoff, S.G. Tan, D.J.S. Hetzel &
J.S.F. Barker (1998). Genetic diversity of Asian Water Buffalo (Bubalus
bubalis): Mitochondrial DNA D-loop and cytochrome
b sequence variation. Animal Genetics 29(4): 253–264. https://doi.org/10.1046/j.1365-2052.1998.00309.x
Lei, C.Z., W.
Zhang, H. Chen, F. Lu, R.Y. Liu, X.Y. Yang, H.C. Zhang, Z.G. Liu, L.B. Yao,
Z.F. Lu & Z.L. Zhao (2007). Independent maternal origin of Chinese Swamp
Buffalo (Bubalus bubalis).
Animal Genetics 38(2): 97–102.
https://doi.org/10.1111/j.1365-2052.2007.01567.x
Librado, P. & J. Rozas (2009). DnaSP v5: A software
for comprehensive analysis of DNA polymorphism data. Bioinformatics
25(11): 1451–1452. https://doi.org/10.1093/bioinformatics/btp187
Mishra, B.P., P.K.
Dubey, B. Prakash, P. Kathiravan, S. Goyal, D.K. Sadana, G.C. Das, R.N. Goswami,
V. Bhasin, B.K. Joshi & R.S. Kataria
(2015). Genetic
analysis of river, swamp and hybrid buffalo of north-east India throw new light
on phylogeography of Water Buffalo (Bubalus bubalis). Journal
of Animal Breeding and Genetics 132(6): 454–456. https://doi.org/10.1111/jbg.12141
Saitou, N. & M. Nei (1987). The neighbor-joining method: a new method for reconstructing
phylogenetic trees. Molecular Biology and Evolution 24(4): 406–425. http://doi.org/10.1093/oxfordjournals.molbev.a040454
Shah, R., S.
Tripathi & B. Bhatta (2017). Translocation of Wild Asian Buffalo (Bubalus arnee): a
way forward to conservation in Nepal, pp. 175–178. In: Proceedings of the
International Buffalo Symposium, 242pp.
Spillet, J.J. & K.M.
Tamang (1966). Wildlife Conservation in Nepal. Journal of the Bombay Natural
History Society 63: 557–572
Swofford, D.L.
(2002). PAUP* Version 4.0 b10. Phylogenetic Analysis
Using Parsimony (* and Other Methods)
Tanaka, K., C.D.
Solis, J.S. Masangkay, K. Maeda, Y. Kawamoto & T.
Namikawa (1996). Phylogenetic relationship among all
living species of the genus Bubalis based
on DNS sequences of the cytochrome b gene. Biochemical Genetics
34(11): 443–452. https://doi.org/10.1007/BF00570125
Tarszisz, E., C.R. Dickman
& A.J. Munn (2014). Physiology in conservation translocations. Conservation Physiology
2(1): 1–19. https://doi.org/10.1093/conphys/cou054
Thompson, J.D.,
T.J. Gibson, F. Plewniak, F. Jeanmougin
& D.G. Higgins (1997). The CLUSTAL X windows interface: Flexible strategies for multiple
sequence alignment aided by quality analysis tools. Nucleic Acids Res 25(24):
4876–4882. https://doi.org/10.1093/nar/25.24.4876
Zhang, Y., Y. Lu,
M. Yindee, K.Y. Li, H.Y. Kuo,
Y.T. Ju, S. Ye, M.O. Faruque, Q. Li, Y. Wang, V.C. Cuong, L.D.
Pham, B. Bouahom, B. Yang, X. Liang, Z. Cai, D. Vankan, W. Manatchaiworakul, N. Kowlim, S. Duangchantrasiri, W. Wajjwalku, B. Colenbrander, Y.
Zhang, P. Beerli, J.A. Lenstra
& J.S. Barker (2016). Strong and stable geographic differentiation of swamp buffalo
maternal and paternal lineages indicates domestication in the China/Indochina
border region. Molecular Ecology 25(7): 1530–1550. https://doi.org/10.1111/mec.13518
Zhang, Y., D. Sun,
Y. Yu and Y. Zhang (2007). Genetic diversity and differentiation of Chinese domestic buffalo
based on 30 microsatellite markers. Animal Genetics 38: 569–575. https://doi.org/10.1111/j.1365-2052.2007.01648.x
Zhang, Y., D. Vankan, Y. Zhang & J.S. Barker (2011). Genetic
differentiation of water buffalo (Bubalus bubalis) populations in China, Nepal and South East
Asia: inferences on the region of domestication of the swamp buffalo. Animal
Genetics 42(4): 366–377. https://doi.org/10.1111/j.1365-2052.2010.02166.x