Journal of Threatened Taxa |
www.threatenedtaxa.org | 26 May 2020 | 12(8): 15852–15863
ISSN 0974-7907 (Online) | ISSN 0974-7893
(Print)
doi: https://doi.org/10.11609/jott.4590.12.8.15852-15863
#4590 | Received 27 September 2018 | Final
received 12 April 2020 | Finally accepted 27 April 2020
Additional description of the
Algae Hydroid Thyroscyphus ramosus (Hydrozoa: Leptothecata: Thyroscyphidae)
from Palk Bay, India with insights into its ecology and genetic structure
G. Arun
1, R. Rajaram 2 & K. Kaleshkumar
3
1, 2, 3 Marine Genomics and Barcoding
Lab, Department of Marine Science, Bharathidasan University, Palkalaiperur, Tiruchirappalli,
Tamil Nadu 620024, India.
1 arun.biotek@gmail.com, 2
drrajaram69@rediffmail.com (corresponding author), 3
kaleshvasanth@gmail.com
Abstract: The Algae hydroid Thyroscyphus ramosus
of the Indian subcontinent is the most easily recognizable fleshy colonial
hydroid playing a vital role in benthic communities. Though this fauna is abundant, it has remained
unexplored for the past nine decades in India.
This study provides a detailed report of the morphology, ecology and
geographical locations of T. ramosus. Morphological traits such as maximum height,
gonophore, and theca twist directions were studied in detail. The molecular biological data confirms the
identity of T. ramosus and its abundance in
Palk Bay, India. Important molecular
markers such as 18S, 16S rRNA sequences of T. ramosus
were analyzed and compared with similar species
in NCBI. Using 18S sequence data, it is
proven that T. ramosus is a distinct and valid
species, however, interestingly the 16S rRNA forms clades with other species of
the same genera (T. fruticosus and T. bedoti) rather than the same species. Moreover the mtCOI
forms a different clade with other genera. Furthermore, these data may enhance
the advancement of identification in non-monophyletic conditions.
Keywords: Distribution, molecular,
morphology, Palk Bay, Thyroscyphus ramosus.
Editor: M. Nithyanandan, Environment
and Life Sciences Research Center, KISR,
Kuwait. Date
of publication: 26 May 2020 (online & print)
Citation: Arun, G., R. Rajaram & K. Kaleshkumar
(2020). Additional
description of the Algae Hydroid Thyroscyphus
ramosus (Hydrozoa: Leptothecata: Thyroscyphidae)
from Palk Bay, India with insights into its ecology and genetic structure. Journal of Threatened Taxa 12(8): 15852–15863. https://doi.org/10.11609/jott.4590.12.8.15852-15863
Copyright: © Arun et al 2020. Creative
Commons Attribution 4.0 International License.
JoTT allows unrestricted use, reproduction,
and distribution of this article in any medium by providing adequate credit to
the author(s) and the source of publication.
Funding: None.
Competing interests: The authors declare no competing interests.
Author details: Dr. G. Arun is a PhD Research scholar in the
Department of Marine Science, who is interested in conventional and
molecular taxonomy and ecology of marine hydrozoa. He is experienced in Island
ecosystem assessment, Coral transplantation, Hydrozoa symbiosis and Coastal
survey. Dr. R. Rajaram is
an Assistant Professor in the Department of Marine Science,
Bharathidasan University and interest in research such as ichthyo taxonomy, marine natural products and
Biotransformation of pollution in marine realm. Dr. K. Kaleshkumar is
a PhD Research scholar in the Department of Marine Science, whose interest in
Biodiversity, traditional and molecular taxonomy and nutritional evaluation of
marine pufferfishes. He is experienced in Pufferfish taxonomy, Biomedical
applications and fish nutritional evaluation.
Author contribution: GA & RR designed the experiments
and analyzed the data; GA performed the sampling; KK & GA
associated the experiments; GA, KK & RR wrote the paper.
Acknowledgements: The authors would like to thank the authorities
of Bharathidasan University and the Department of Marine Science for
the facilities provided.
Introduction
Palk Bay on the southeastern
coast of India covers ≈296km of coastline and up to 15m depth range considered
as a backbone of productivity which supports a wide variety of fauna and
flora. Palk Bay is known for its rich
marine biodiversity which comprises: 302 marine algae, 51 Foraminifera, 12
tintinnids, 143 flora, 275 sponges, 123 non-coral coelenterates, 128 stony
corals, 100 Polyzoa, 75 Polychaeta, 651 Crustacea, 733 Mollusca, 274
Echinodermata, 66 Prochordata, 580 fishes, five
turtles, 61 birds, and 11 mammals (Kasim 2015).
Palk Bay has a sandy rubble bottom, a shelf region that has a maximum
temperature range of 26–28⁰C, and consists of intense upwelling regions (Kumaraguru et al. 2008).
The class Hydrozoa has the largest number of
species under the phylum Cnidaria. They
are renowned for familiar forms of benthic, pelagic, and combined life cycle
stages (Bouillon et al. 2006). Their
biomass and life cycle stages are the indicator for food abundance and
upwelling regions in the water column (Boero et al.
2008). These omnipresent voracious
carnivore hydrozoans are one of the common bio-fouling components. These predators consume larvae of fishes,
crustaceans, plankton, and benthic organisms, whereas some hydrozoan species
directly consume dissolved organic matter and nutrients (Collins et al. 2006;
Di Camillo et al. 2017). These voracious
benthic feeders are involved as members in the energy transformation cycle, in
the upwelling regions. It is considered
so based on their mass and richness (Orejas et al.
2000). Thyroscyphus
ramosus is one of the widely reported species in
the Caribbean region (Germerden-Hoogeven Van 1965;
Galea 2008) and regions of southern and western Atlantic coast (Allman 1888; Vervoort 1959; Winston 1982, 2009; Migotto
et al. 1993), Mexican Gulf (Calder & Cairns 2009), Brazil (Shimabukuro
& Marques 2006), South Africa (Warren 1907), and the Indian Ocean (Leloup 1932). The
diversity of the genus Thyroscyphus were
previously reported from the subtidal zone, at 1m depth (Kelmo
& Vargas 2002) and in Cuba the species was reported to a maximum of 183–457
m depth (Nutting 1915). This species is
associated with many biotic and abiotic forms and acts as a host for many
organisms like other hydroids and sponges.
The size ranges from 3cm to 25cm (Kelmo &
Vargas 2002) during all the seasons in the breakwater region (Winston
1982). The distribution and composition
of marine species, extending their geographical locations based on the suitable
climate and environmental changes to survive and maintain their live forms
(Hughes et al. 2000). Most research
contributions were focused on commercially valuable groups rather than the
inconspicuous non-commercial value benthic communities (González-Duarte et al.
2014).
In the marine ecosystem, the morphological
similarities of the species and confusions in identification are resolved
through DNA barcoding (Moura et al. 2008).
This hampering was resolved with genetic analysis (Trivedi et al. 2016). Several gene regions, such as 16S, 18S, 28S,
mtCOI and internal transcribed spacer 1 (ITS1),
however, were employed to reveal their taxonomic relationships (Schierwater & Ender 2000; Collins et al. 2005;
Govindarajan et al. 2006; Schuchert 2014). Mammen (1963,
1965a,b) contributed taxonomic information on c. 126 species of hydroids from
southern India. Among hydroids, the
genus Thyroscyphus is a large fleshy benthic
hydroid colony that is easily visible underwater. F.H. Gravely (1927) recorded Thyroscyphus junces
from the Pamban bridge and chank
bed area. Hora (1925) collected three
smaller colonies of Thyroscyphus ramosus (3cm size) from Shingle Island, Gulf of Mannar. Till date,
this is the only known record of this genus from India. In this present study, year round abundance
of Thyroscyphus ramosus
at Rameshwaram coast, Palk Bay, Gulf of Mannar region is documented. The cryptic behavior,
distribution information, ecology, habitat, and phylogenetic relationships of
the hydroid species are still lacking, particularly in India. The main objective of this study is to
re-describe the species and conduct a preliminary assessment of their
phylogenetic relationships using morphological observations, 18S rRNA, 16S
rRNA, and mtCOI gene of this species.
Material and Methods
Hydroid specimens were collected at Olakuda lighthouse area, Rameshwaram
coast, Palk Bay (9.320188°N 79.340040° E) Gulf of Mannar
region, Tamil Nadu, India, from September 2016 to September 2017 by snorkeling from shoreline up to 5m depth and as bycatch
obtained from crab nets operated at 5–15 m (Figure 1). The collected hydroid specimen colonies were
photographed before fixing in 4% neutralized formaldehyde solution to observe
the color and morphological traits to avoid post
preservation changes (Hissmann 2005; Di Camillo et
al. 2010). Part of the whole colony was
preserved in 99% ethanol for genetic studies (Nikulina
et al. 2013; Maggioni et al. 2016). The diagrammatic details of the colony were
obtained using a light microscope and morphological traits were also examined
using ΣIGMA-Zeiss-Scanning Electron Microscopy.
Samples were identified using pictorial keys (Allman
1877; Winston 1982; Shimabukuro & Marques 2006; Calder & Cairns 2009),
and online identification/literature available in the WoRMS
database (Schuchert 2018). Voucher specimen samples were submitted at
the museum in the marine science department, Bharathidasan University, Marine
Genomics and Barcoding Lab (MGBL) and obtained the specimen code
(DMS-RR-HTR1-GoM-2016). The colonies
were examined for the presence of gonophores in order to evaluate the period of
sexual reproduction. The specimens were
fixed with seawater and glutaraldehyde buffer for scanning electron microscopic
(SEM) investigation (Di Camillo et al. 2012).
Sequencing genetic regions
The total genomic DNA was extracted in 99% ethanol
preserved hydrozoa sample, following a modified
protocol (Sambrook et al. 1989) from the ethanol-fixed specimen, by CAGL
extraction protocol using Qiagen kit (Mandal et al. 2014). 0.7% agarose gel along with 1Kb DNA ladder was
used to assess the quality of obtained DNA and their quality was estimated
using a Biophotometer (Eppendorf). Universal Forward & Reverse primers,
amplification of 16SrRNA gene 18SrRNA gene and COI gene were carried out and 2%
agarose gel along with 100bp DNA ladder were used to confirm the PCR-generated
amplicons. The amplified product was
subjected to purification using the GeneJET PCR
purification kit (Thermo Scientific, EU-Lithuania) in
order to remove the primer-dimer and other contaminations. The acquired PCR products were subjected to
sequencing using universal primers. For
partial 16S rRNA (Forward primer: 5’- CGCCTGTTTATCAAAAACAT-3’ and Reverse
primer: 5’- GGTTTGAACTCAGATCATGT-3’), for partial 18S rRNA (Forward primer: 5’-
CAGCAGCCGCGGTAATTCC-3’ and Reverse primer: 5’- CCCGTGTTGAGTCAAATTAAGC -3’), for
partial COI gene (Forward primer: 5’- GGTCAACAAATCATAAAGATATTGG -3’ and Reverse
primer: 5’- TAAACTTCAGGGTGACCAAAAAATCA -3’) in forward and reverse directions
using Genetic Analyzer 3500 using CAGL standardized protocol for genetic
analysis of the hydrozoa species (Mandal et al.
2014). We prepared the dataset from
submitted sequences in NCBI and similar sequence from NCBI-BLAST (Basic Local
Alignment Searching Tool). The multiple sequence alignment was performed using Clustal X 2.0 and sequence-based evolutionary tree was
performed using MEGA 7 (Tamura et al. 2013) for the estimation of genetic
variations among the obtained clades of the separate molecular locus.
Results and Discussion
Kingdom Animalia
Phylum Cnidaria Verrill,
1865
Class Hydrozoa Owen, 1843
Subclass Hydroidolina
Collins, 2000
Order Leptothecata
Cornelius, 1992
Superfamily Sertularioidea Lamouroux, 1812
Family Thyroscyphidae Stechow, 1920
Genus Thyroscyphus Allman,
1877
Thyroscyphus ramosus Allman, 1877
Species natural history
The colony is transparent, pale yellow in color, smooth outer wall reaches a maximum height from hydrorhyza to tip of hydrocaulus
43.5cm without gonotheca and 24cm with gonophore. Stolen are webbed and entwined tightly with
the substrates. Among the total 13 hydrorhyza two are infertile hydrorhyza
(Figure 2A). Alternate Polysiphonic hydrocaulus from the
hydrorhyza divided with regular intervals after every
two hydrothecal pedicle internodes with a slight bent
on the left and right alternative of oblique nodes (Figure 2B). Branches 8-–34 with length variations were
noted, smaller in upper and lower, larger branch in the middle of hydrorhyza. The
branch length 3.2cm to a maximum of 8.4cm.
The straight basal bottom becomes slender and crooked. Length of unfertile colony tube 1.4cm (Figure
2F). In a fertile colony after 1.8cm the
distal apophysis with pedicellate hydrotheca observed
distal alternate sides of entire hydrorhyza with
regular distance. The supporting
apophysis wider. Pedicle spirally
twisted alternately (right pedicle twisted clockwise, left pedicles twisted
anti-clockwise) ridged and shorter carrying hydrotheca
at the upper end of the thick annulus (Figure 2D). Pedicle and hydrotheca
joints distinctive (Figure 2C). Hydrotheca base larger than pedicle and cylindrical bottom
and the top oblique have thick marginal ring and above the margin four blended
cusps (Figure 2E). The lower side of hydrotheca distally straight and aboral side slightly
convex, basal wall thick, annulus and concave on pedicle joint. Hydrotheca
asymmetrical, alternate, thick and oblique wall, and gonotheca rise
beneath. Gonotheca conical shaped,
situated beneath hydrotheca or on stem, larger and
thin perisarc than hydrotheca. Gonothecal pedicle
is shorter than hydrothecal pedicle, annulus thicker
on the joint to gonothecal base. The gonothecal rim
is thick and oblique marginal equidistant on opening. Some are conspicuously funnel-shaped. Measurements of hydrocaulus
length between hydranths 1.156–2.983 mm of internode 225µm diameter, at node
356µm, 0–4 pedicel annulations. Hydrotheca length maximum 578µm, marginal cusp height 38–56
µm apophysis length 180–257 µm diameter, 369µm at rim maximal diameter. Gonotheca maximum 643µm length, 475µm on
mouth, wider on middle 597µm maximal diameter, marginal ring 26µm height,
pedicle 71µm on the aboral side (Image 1).
The SEM images show the specimen characteristics of the skeleton and their
actual thickness and the parts were clear in the image (Image 2).
The species were collected and described 91 years ago,
from Shingle Island, Gulf of Mannar, India by Hora
(1925). Morphology was distinguished by
four cusps on the hydrotheca marginal ring with a
single operculum. Length of the colony
3m to 24cm, with and without gonotheca was recorded. In this present study, the maximum of 43.5cm
without gonophore and 24cm with gonophore collected. In the earlier studies of the species from
Shingle Island, Gulf of Mannar only 3cm, without
gonophore (Leloup 1932; Migotto
& Vervoort 1996) was recorded. After Winston’s (1982), observation at Fort
Pierce, Florida, North Beach breakwater, the year-round abundance of this
species was recorded only in Palk Bay, Olakuda
lighthouse region.
Ecology
The colonies occur in areas with strong current. This species grows on substratum such as
sponges, shells of bivalves, on the sides of coral rock, and the sea surface
covered with sandy rubbles also in vertical walls and surf zones. Occurs in
shallow areas to a maximum depth of 457m.
Phylogenetic analysis (Graphical representation)
We constructed the phylogenetic tree using the neighbor-joining algorithm with 1,000 bootstrap replicates
to identify the origin and replication of Thyroscyphus
ramosus for 18S rRNA, 16S rRNA and mtCOI gene (Saitou & Nei
1987). The sequence-based evolutionary
tree was constructed using MEGA 7.0, (Kumar et al. 2016) with bootstrap values
of >50% numbered at the nodes. For
the targeted sequence of T. ramosus 18S rRNA,
16S rRNA, species sequence from genus Halecium
was used as outgroup and for the mtCOI gene Scopalina ruetzleri
UCMPWC992 was used as the out-group due to the unavailability of sequence from
the genus Halecium.
From the result of 18S rRNA gene-based tree was separated
into two major clades from the out-group lineage of Halecium
labrosum MHNG INVE29030. Our target species Thyroscyphus
ramosus DMS-HATR-01 is highly supported with
maximum bootstrap value to another specimen of the same species Thyroscyphus ramosus
MZUSP:1664. The closely related second
clade was formed with Cnidoscyphus marginatus MHNG INVE35477, which genus was accepted as Thyroscyphus marginatus
(Allman 1877). Other minor supported
clades of the Hydrodendron mirabile MHNG INVE34779, Cladocarpus
integer MHNG INVE48754, Macrorhynchia phoenicea MHNG INVE36813, Macrorhynchia
philippina DMS-HAMPL-01 and Macrorhynchia
sibogae MHNG INVE36832, species of superfamily Plumularioidea.
Second major clade consists of Amphisbetia
operculata MHNG INVE34014, Diphasiafallax
MHNG INVE29950, Sertularia distans DMS-HASD-01, Sertularia
cupressina MHNG INVE29949, and Sertularia
argentea are grouped with each other (Figure 3).
The result of the 16S rRNA gene-based tree was
separated into two major clades from the out-group lineage of Halecium mediterraneum
DNA122. The targeted species clade of Thyroscyphus ramosus
DMS-HATR-02 highly supported with another specimen of the same genus T.
bedoti MAL09-048, T. fruticosus DNA1250, T. marginatus
bth.15.89 and T. fruticosus REU13-002
with maximum bootstrap value. Another
major clade consists of Sertularella ellisii DNA1237, S. mediterranea
MHNG INVE32948, S. polyzonias DNA1236, S.
ellisii MHNG INVE32156, S. africana MHNG INVE34017, S. gayi, S. simplex MHNG-HYD-DNA1135, S. sanmatiasensis, S. rugosa MHNG INVE29032. Interestingly the same species of other
strain Thyroscyphus fruticosus
REU13-002 was In the closest clade and also in the nearest common ancestral
clade, similar to the clades of Sertularella
ellisii DNA1237 and S. ellisii
MHNG INVE3215 may be originated from various species of Sertularella
genus (Figure 4).
The result of mtCOI
gene-based tree was separated into many sub-clades. The target species Thyroscyphus
ramosus DMS-HA-Tr-Hap-01 was formed from the
separate sub-clade from the same genus of the other species. The Nanomiacara
Naca53 clade form as the ancestral for all above-mentioned sequences and the
Scopalina ruetzleri UCMPWC992
act as an out-group for the constructed phylogenetic tree (Figure 5). This is the first report from an Asian
country on 16S rRNA analysis and mtCO1 gene sequence of Thyroscyphus ramosus in
the biological database. So, the
identified phylogenetic neighbor organisms may act as
a reference to our target organism. In
future, the reported sequences may use as a reference data to our target
species.
Pairwise genetic distance (statistical representation)
We inferred our result with the second approach using
pairwise distance (statistical data).
From the result of genetic diversity of 18S rRNA, 16S rRNA and mtCOI gene were identified in the pairwise distance range
between (0.0–0.074) in 18S rRNA (shown in Table 1). It reveals that no phylogenetic variation may
occur in the 18S rRNA gene whereas, 16S rRNA gene, the distance arises in
between the range of (0.008–0.154) and for mtCOI gene
(0.052–0.272) (as shown in Tables 2 & 3).
This slight genetic variation exposed in both 16S rRNA and the mtCOI gene. Even if
the genes and species are different, no higher genetic variation originated
from our results; this is due to the similarity between the sequence and its
family.
Conclusion
The region in Palk Bay supports the highly diverse and
abundant benthic Algal Hydroid T. ramosus. In places like Fort Pierce, Florida, North
Beach breakwater, the species are observed year-round due to favorable environmental conditions. The abundant distribution is due to complex
reasons such as nutrient availability, littoral topography and suitable
conditions for their production and survival.
To preserve biodiversity of the benthic indicator species, stringent
environmental management practices have to be implemented in this area.
Table 1. Pairwise genetic distance was computed for
18S rRNA gene based phylogenetic related species of Thyroscyphus
ramosus.
|
Organism |
Access no. |
1 |
2 |
3 |
4 |
5 |
6 |
7 |
8 |
9 |
10 |
11 |
12 |
13 |
14 |
|
Thyroscyphus ramosus* |
MH232033 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Thyroscyphus ramosus |
KM822775 |
0.002 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Hydrodendron mirabile |
FJ550568 |
0.026 |
0.027 |
|
|
|
|
|
|
|
|
|
|
|
|
|
Cnidoscyphus marginatus |
FJ550573 |
0.027 |
0.029 |
0.043 |
|
|
|
|
|
|
|
|
|
|
|
|
Cladocarpus integer |
FJ550597 |
0.028 |
0.029 |
0.008 |
0.041 |
|
|
|
|
|
|
|
|
|
|
|
Macrorhynchia sibogae |
FJ550586 |
0.033 |
0.033 |
0.014 |
0.042 |
0.013 |
|
|
|
|
|
|
|
|
|
|
Macrorhynchia phoenicea |
FJ550584 |
0.033 |
0.033 |
0.014 |
0.039 |
0.010 |
0.003 |
|
|
|
|
|
|
|
|
|
Macrorhynchia philippina |
MK063801 |
0.033 |
0.033 |
0.014 |
0.044 |
0.013 |
0.003 |
0.006 |
|
|
|
|
|
|
|
|
Sertularia distans |
MKo63802 |
0.037 |
0.039 |
0.037 |
0.046 |
0.042 |
0.044 |
0.044 |
0.048 |
|
|
|
|
|
|
|
Diphasia fallax |
FJ550557 |
0.038 |
0.039 |
0.044 |
0.046 |
0.046 |
0.049 |
0.049 |
0.053 |
0.010 |
|
|
|
|
|
|
Amphisbetia operculata |
FJ550561 |
0.039 |
0.041 |
0.039 |
0.044 |
0.041 |
0.042 |
0.042 |
0.046 |
0.010 |
0.014 |
|
|
|
|
|
Sertularia cupressina |
FJ550539 |
0.039 |
0.041 |
0.039 |
0.044 |
0.044 |
0.046 |
0.046 |
0.049 |
0.005 |
0.010 |
0.011 |
|
|
|
|
Sertularia argentea |
FJ550520 |
0.039 |
0.041 |
0.039 |
0.044 |
0.044 |
0.046 |
0.046 |
0.049 |
0.005 |
0.010 |
0.011 |
0.000 |
|
|
|
Halopteris carinata |
KT722401 |
0.039 |
0.037 |
0.034 |
0.049 |
0.039 |
0.036 |
0.039 |
0.039 |
0.041 |
0.046 |
0.036 |
0.042 |
0.042 |
|
|
Halecium labrosum |
FJ550550 |
0.072 |
0.072 |
0.067 |
0.070 |
0.072 |
0.070 |
0.074 |
0.074 |
0.063 |
0.062 |
0.055 |
0.065 |
0.065 |
0.062 |
*Target species
Table 2. Pairwise genetic distance was computed for
16S rRNA gene based phylogenetic related species of Thyroscyphus
ramosus.
|
Organism |
Access no. |
1 |
2 |
3 |
4 |
5 |
6 |
7 |
8 |
9 |
10 |
11 |
12 |
13 |
14 |
|
Thyroscyphus ramosus* |
MH392732 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Thyroscyphus bedoti |
MH108450 |
0.008 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Thyroscyphus fruticosus |
MG811643 |
0.015 |
0.019 |
|
|
|
|
|
|
|
|
|
|
|
|
|
Thyroscyphus fruticosus |
MG108467 |
0.098 |
0.096 |
0.091 |
|
|
|
|
|
|
|
|
|
|
|
|
Sertularella gayi |
AM888340 |
0.116 |
0.114 |
0.116 |
0.127 |
|
|
|
|
|
|
|
|
|
|
|
Sertularella ellisii |
MG811636 |
0.120 |
0.120 |
0.123 |
0.124 |
0.041 |
|
|
|
|
|
|
|
|
|
|
Sertularella polyzonias |
MG811635 |
0.132 |
0.129 |
0.134 |
0.136 |
0.037 |
0.019 |
|
|
|
|
|
|
|
|
|
Sertularella simplex |
KX355446 |
0.125 |
0.123 |
0.129 |
0.131 |
0.023 |
0.029 |
0.035 |
|
|
|
|
|
|
|
|
Sertularella sanmatiasensis |
FN424141 |
0.125 |
0.123 |
0.130 |
0.144 |
0.039 |
0.039 |
0.045 |
0.031 |
|
|
|
|
|
|
|
Sertularellala genoides |
FJ550478 |
0.122 |
0.120 |
0.127 |
0.131 |
0.037 |
0.017 |
0.021 |
0.017 |
0.039 |
|
|
|
|
|
|
Sertularella africana |
FJ550490 |
0.134 |
0.132 |
0.138 |
0.128 |
0.039 |
0.033 |
0.035 |
0.021 |
0.047 |
0.031 |
|
|
|
|
|
Sertularella mediterranea |
FJ550479 |
0.124 |
0.122 |
0.127 |
0.135 |
0.039 |
0.017 |
0.023 |
0.031 |
0.043 |
0.021 |
0.029 |
|
|
|
|
Thyroscyphus marginatus |
MH361368 |
0.118 |
0.114 |
0.116 |
0.117 |
0.131 |
0.131 |
0.143 |
0.126 |
0.122 |
0.135 |
0.138 |
0.140 |
|
|
|
Sertularella rugosa |
AY787906 |
0.125 |
0.122 |
0.129 |
0.138 |
0.037 |
0.045 |
0.045 |
0.031 |
0.027 |
0.039 |
0.039 |
0.045 |
0.122 |
|
|
Halecium mediterraneum |
MG811603 |
0.147 |
0.149 |
0.154 |
0.147 |
0.108 |
0.097 |
0.104 |
0.104 |
0.108 |
0.101 |
0.100 |
0.108 |
0.161 |
0.112 |
*Target species
Table 3. Pairwise genetic distance was computed for mtCOI gene based phylogenetic related species of Thyroscyphus ramosus.
|
Organism |
Access no. |
1 |
2 |
3 |
4 |
5 |
6 |
7 |
8 |
9 |
10 |
11 |
12 |
13 |
14 |
15 |
16 |
17 |
|
Nemopsis bachei |
JN700947 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Sarsia striata |
KT981905 |
0.172 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Turritopsis chevalense |
KX096597 |
0.180 |
0.192 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Obelia dichotoma |
KX665223 |
0.165 |
0.159 |
0.180 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Hartlaubella gelatinosa |
KX665236 |
0.196 |
0.185 |
0.153 |
0.168 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Sarsia lovenii |
KT981910 |
0.176 |
0.177 |
0.174 |
0.166 |
0.080 |
|
|
|
|
|
|
|
|
|
|
|
|
|
Dendrogramma |
KU716054 |
0.188 |
0.209 |
0.053 |
0.176 |
0.163 |
0.176 |
|
|
|
|
|
|
|
|
|
|
|
|
Nanomiacara |
GQ120029 |
0.199 |
0.195 |
0.178 |
0.189 |
0.168 |
0.172 |
0.172 |
|
|
|
|
|
|
|
|
|
|
|
Halopsis ocellata |
MF000506 |
0.182 |
0.191 |
0.230 |
0.181 |
0.192 |
0.177 |
0.232 |
0.187 |
|
|
|
|
|
|
|
|
|
|
Clytia gracilis |
KX665167 |
0.198 |
0.186 |
0.165 |
0.173 |
0.114 |
0.115 |
0.163 |
0.146 |
0.184 |
|
|
|
|
|
|
|
|
|
Eutonina indicans |
MF000496 |
0.206 |
0.186 |
0.196 |
0.196 |
0.122 |
0.112 |
0.196 |
0.179 |
0.195 |
0.143 |
|
|
|
|
|
|
|
|
Sarsia princeps |
MG422634 |
0.201 |
0.189 |
0.164 |
0.182 |
0.158 |
0.142 |
0.177 |
0.182 |
0.227 |
0.153 |
0.167 |
|
|
|
|
|
|
|
Scopalina ruetzleri |
AY561976 |
0.186 |
0.204 |
0.052 |
0.172 |
0.161 |
0.174 |
0.010 |
0.174 |
0.230 |
0.157 |
0.192 |
0.176 |
|
|
|
|
|
|
Eirene brevistylus |
KF962116 |
0.223 |
0.236 |
0.267 |
0.232 |
0.249 |
0.214 |
0.272 |
0.260 |
0.234 |
0.223 |
0.241 |
0.265 |
0.269 |
|
|
|
|
|
Eutonina indicans |
MH559269 |
0.208 |
0.185 |
0.189 |
0.204 |
0.136 |
0.124 |
0.198 |
0.168 |
0.204 |
0.151 |
0.075 |
0.163 |
0.198 |
0.257 |
|
|
|
|
Nemopsis bachei |
JN700947 |
0.203 |
0.184 |
0.166 |
0.182 |
0.162 |
0.148 |
0.178 |
0.188 |
0.234 |
0.155 |
0.171 |
0.013 |
0.178 |
0.269 |
0.167 |
|
|
|
Sarsia striata |
KT981905 |
0.206 |
0.184 |
0.206 |
0.194 |
0.149 |
0.134 |
0.194 |
0.180 |
0.189 |
0.142 |
0.100 |
0.167 |
0.196 |
0.250 |
0.098 |
0.165 |
|
|
Turritopsis chevalense |
KX096597 |
0.190 |
0.160 |
0.188 |
0.127 |
0.168 |
0.161 |
0.192 |
0.173 |
0.182 |
0.163 |
0.176 |
0.189 |
0.190 |
0.254 |
0.179 |
0.198 |
0.182 |
*Target species
For
figures & images - - click here
References
Allman, G.J. (1888). Report on the Hydroida
dredged by H.M.S. Challenger during the years 1873-1876. Part I. Plumularidae. Report on the scientific results of the
voyage of H.M.S. Challenger 1873–1876. Zoology 7: 1–54. https://doi.org/10.5962/bhl.title.6513
Allman, G.J. (1877). Report on the Hydroida :
collected during the exploration of the Gulf Stream by L. F. de Pourtalès, assistant United States Coast Survey. Welch,
Bigelow and Company, University Press, Cambridge, 166pp.
Boero, F., J. Bouillon, C. Gravili,
M.P. Miglietta, T. Parsons & S. Piraino (2008). Gelatinous plankton: irregularities rule the world
(sometimes). Marine Ecology Progress Series 356: 299–310. https://doi.org/10.3354/meps07368
Bouillon, J., C. Gravili,
J.M. Gili & F. Boero (2006). An introduction to Hydrozoa. Memories of the National Museum of Natural History
Volume 194, Museum Scientific Publications, Paris, 591pp.
Calder, D.R. & S.D. Cairns (2009). Hydroids (Cnidaria: Hydrozoa)
of the Gulf of Mexico, Pp. 381–394 In: Felder, D.L. & D.K. Camp (eds.), Gulf
of Mexico, Origins, Waters, and Biota. Volume 1, Biodiversity, Texas
A&M University Press, College Station, 1393pp.
Collins, A.G., S. Winkelmann, H. Hadrys
& B. Schierwater (2005). Phylogeny of Capitata and Corynidae (Cnidaria, Hydrozoa) in
light of mitochondrial 16S rDNA data. Zoologica
Scripta 34(1): 91–99. https://doi.org/10.1111/j.1463-6409.2005.00172.x
Collins, A.G., P. Schuchert,
A.C. Marques, T. Jankowski, M. Medina & B. Schierwater
(2006). Medusozoan phylogeny and character
evolution clarified by new large and small subunit rDNA data and an assessment
of the utility of phylogenetic mixture models. Systematic Biology 55(1):
97–115. https://doi.org/10.1080/10635150500433615
Di Camillo, C.G., M. Bo, S. Puce & G. Bavestrello (2010). Association between Dentithecahabereri
(Cnidaria: Hydrozoa) and two zoanthids. Italian
Journal of Zoology 77(1): 81–91. https://doi.org/10.1080/11250000902740962
Di Camillo, C.G., G. Bavestrello,
C. Cerrano, C. Gravili, S. Piraino, S. Puce & F. Boero
(2017). Hydroids (Cnidaria, Hydrozoa): a neglected component of animal forests, pp.
397-427. In: Marine Animal Forests: The Ecology of Benthic Biodiversity
Hotspots, Springer, Cham, 1366pp. https://doi.org/10.1007/978-3-319-21012-4_11
Di Camillo, C.G., G.M. Luna, M. Bo, G. Giordano, C. Corinaldesi & G. Bavestrello
(2012). Biodiversity of prokaryotic
communities associated with the ectoderm of Ectopleura
crocea (Cnidaria, Hydrozoa).
PLoS One 7(6): e39926. https://doi.org/10.1371/journal.pone.0039926
Galea, H.R. (2008). On a collection of shallow-water hydroids (Cnidaria: Hydrozoa) from Guadeloupe and Les Saintes, French Lesser
Antilles. Zootaxa 1878: 1–54. https://doi.org/10.5281/zenodo.184149
Govindarajan, A.F., F. Boero
& K.M. Halanych (2006). Phylogenetic analysis with multiple markers indicates
repeated loss of the adult medusa stage in Campanulariidae
(Hydrozoa, Cnidaria). Molecular Phylogenetics and
Evolution 38(3): 820-–834. https://doi.org/10.1016/j.ympev.2005.11.012
González-Duarte, M.M., C. Megina,
& S. Piraino (2014). Looking for long-term changes in hydroid assemblages
(Cnidaria, Hydrozoa) in Alboran
sea (south-western Mediterranean): a proposal of a monitoring point for the
global warming. Helgoland Marine Research, 68: 511–521. https://doi.org/10.1007/s10152-014-0406-3
Gravely, F.H. (1927). The littoral fauna of Krusudai
Island in the Gulf of Mannar, orders Decapoda (except Paguridae) and Stomatopoda. Bulletin of the Madras Government Museum
1: 135–155.
Hissmann, K. (2005). In situ observations on benthic siphonophores (Physonectae: Rhodaliidae) and
descriptions of three new species from Indonesia and South Africa. Systematics
and Biodiversity 2(3): 223–249. https://doi.org/10.1017/S1477200004001513
Hora, L.S. (1925). In A collection of hydropolypes
belonging to the Indian Museum in Calcutta. Records of the Indian Museum,
179pp.
Hughes, L (2000). Biological consequences of global warming: is the
signal already apparent?. Trends in Ecology & Evolution, 15(2):
56-61. https://doi.org/10.1016/S0169-5347(99)01764-4
Kelmo, F. & R. Vargas (2002). Anthoathecatae and Leptothecatae hydroids
from Costa Rica (Cnidaria: Hydrozoa). Revista de Biología
Tropical 50(2): 599–627.
Kumaraguru, A.K., V. Edwin Joseph, M. Rajee
& T. Balasubramanian (2008). Palk
Bay - Information and Bibliography, CAS in Marine Biology, Annamalai
University, Parangipettai and Centre for Marine and
Coastal Studies, Madurai Kamaraj University, Madurai, 227pp.
Leloup, E. (1932). A collection of hydropolypes
belonging to the Indian Museum in Calcutta. Records of the Indian Museum,
34(2): 131–170.
Maggioni, D., S. Montano, D. Seveso & P. Galli (2016). Molecular evidence for cryptic species in Pteroclavakrempfi (Hydrozoa, Cladocorynidae) living in association with alcyonaceans. Systematics
and Biodiversity 14(5): 484–493. https://doi.org/10.1080/14772000.2016.1170735
Migotto, A.E. & W. Vervoort
(1996). The benthic shallow water
hydroids (Cnidaria, Hydrozoa) of the coast of São Sebastião, Brazil, including a checklist of Brazilian
hydroids. Nationaal Natuurhistorisch
Museum, 306: 25-125.
Mammen, T.A. (1963). On a collection of hydroids from South India. I.
Suborder Athecata. Journal of the Marine
Biological Association of India 5(1): 27–61.
Mammen, T.A. (1965a). On a collection of hydroids from South India. III.
Family Plumulariidae. Journal of the Marine
Biological Association of India 7(1): 291–324.
Mammen, T.A. (1965b). On a collection of hydroids from South India. II.
Suborder Thecata (excluding family Plumulariidae). Journal of the Marine Biological Association
of India 7: 1–57.
Migotto, A.E., C.G. Tiago & A.R.M Magalhaes
(1993). A faunal survey of the marine
molluscs of the Channel of São Sebastião, SP, Brazil:
Gastropoda, Bivalvia, Polyplacophora
and Scaphopoda. Bulletin of the Instituto Oceanografico,
41(1–2): 13–27. https://doi.org/10.1590/S0373-55241993000100002
Mandal, A., M. Varkey, S.P. Sobhanan, A.K. Mani, A. Gopalakrishnan, G. Kumaran, A. Sethuramalingam, P. Srinivasan & Y.C.T. Samraj (2014).
Molecular markers reveal only two mud crab species of genus Scylla (Brachyura: Portunidae) in Indian
coastal waters. Biochemical Genetics 52(7–8): 338–354. https://doi.org/10.1007/s10528-014-9651-z
Kasim, M.H. (2015). Resources and livelihoods of the Palk Bay: Information
from India & Sri Lanka. Conference: International Academic Workshop
Resources Conservation and Alternate Livelihood Opportunities in Coastal Tamil
Nadu (ReCAL’15), 28pp.
Moura, T., M.C. Silva, I. Figueiredo,
A. Neves, P.D. Munoz, M.M. Coelho & L.S. Gordo
(2008). Molecular barcoding of north-east
Atlantic deep-water sharks: species identification and application to fisheries
management and conservation. Marine and Freshwater Research 59(3):
214–223. https://doi.org/10.1071/MF07192
Nikulina, E.A., H. De Blauwe &
O. Reverter-Gil (2013). Molecular phylogenetic analysis confirms the species
status of Electra verticillata (Ellis and Solander, 1786), pp 217-236. In: Ernst, A. et al. (Ed.) Bryozoan
Studies 2010. Lecture Notes in Earth System Sciences, Springer,
Berlin, Heidelberg, 448pp. https://doi.org/10.1007/978-3-642-16411-8_15
Nutting, C.C. (1915). American Hydroids. Part 3, The Campanularidae
and the Bonneviellidae. Species Bulletin - United
States National Museum (Washington) 27–126
Orejas, C., J.M. Gili, V. Alvà
& W. Arntz (2000). Predatory impact of an epiphytic hydrozoan in an
upwelling area in the Bay of Coliumo (Dichato, Chile). Journal of Sea Research, 44:
209–220. https://doi.org/10.1016/S1385-1101(00)00057-5
Owen, R. (1843). Lectures on the comparative anatomy and physiology of
the invertebrate animals: delivered at the Royal College of Surgeons, London,
Longman, Brown, Green and Longmans, pp392. https://doi.org/10.5962/bhl.title.6788
Schierwater, B. & A. Ender (2000). Sarsiamarii n. sp. (Hydrozoa, Anthomedusae) and the use of 16S rDNA sequences for
unpuzzling systematic relationships in Hydrozoa. Scientia
Marina 64: 117–122. https://doi.org/10.3989/scimar.2000.64s1117
Schuchert, P. (2014). High genetic diversity in the hydroid Plumulariasetacea: a multitude of cryptic species or
extensive population subdivision? Molecular Phylogenetics and Evolution
76: 1–9. https://doi.org/10.1016/j.ympev.2014.02.020
Shimabukuro, V.A.N.E.S.S.A. & A.C. Marques (2006).
Morphometrical analysis,
histology, and taxonomy of Thyroscyphusramosus
(Cnidaria, Hydrozoa) from the coast of Brazil. Zootaxa 1184(1): 29–42. https://doi.org/10.11646/zootaxa.1184.1.2
Trivedi, S., A.A. Aloufi,
A.A. Ansari & S.K. Ghosh (2016). Role of DNA barcoding in marine biodiversity
assessment and conservation: an update. Saudi Journal of Biological Sciences
23(2): 161–171. https://doi.org/10.1016/j.sjbs.2015.01.001
Gemerden-Hoogeveen, van G.C.H. (1965). Hydroids of the Caribbean: Sertulariidae,
Plumulariidae and Aglaopheniidae.
Studies on the fauna of Curacao and other Caribbean Islands 22(1): 1–87.
Vervoort, W. (1959). The Hydroida of the tropical
west coast of Africa. Atlantide Report. Scientific
Results of the Danish Expedition to the coasts of tropical West Africa,
1945–1946. Copenhagen, Danish Science Press, pp325.
Warren, E. (1907). On Parawrightiarobusta gen.
et sp. nov., a hydroid from the Natal coast; and also
an account of a supposed schizophyte occurring in the
gonophores. Annals of the Natal Government Museum 1: 187–208.
Winston, J.E. (1982). Marine bryozoans (Ectoprocta)
of the Indian River area (Florida). Bulletin of the American Museum of
Natural History, 176pp.
Winston, J.E. (2009). Stability and Change in the Indian River Area
Bryozoan Fauna over a Twenty-Four Year Period, pp. 299-240. In: Proceedings of the Smithsonian Marine Science
Symposium, Smithsonian Institution Scholarly press, Washington D.C. pp529.