Genetic diversity of the
Critically Endangered Philippine
Eagle Pithecophaga jefferyi (Aves: Accipitridae) and notes on its
conservation
Adrian U. Luczon 1,
Ian Kendrich C. Fontanilla 2, Perry S. Ong 3, Zubaida U.
Basiao 4, Anna Mae T. Sumaya 5 & Jonas P. Quilang6
1,2,3,4,6 Institute of Biology,
University of the Philippines, Diliman, Quezon City 1101, Philippines
5 Philippine Eagle Foundation,
Malagos, Baguio District, Davao City 8000, Philippines
1 adrian.luczon@gmail.com
(corresponding author), 2 ianfontanilla@hotmail.com, 3 ongperry@yahoo.com,4 zbasiao08@gmail.com, 5 annamae_twisted@yahoo.com, 6jpquilang@gmail.com
Abstract: The Philippine EaglePithecophaga jefferyi is a diurnal raptor endemic to the Philippines. Its distribution is restricted to
remaining forests on the islands of Luzon, Samar, Leyte and Mindanao. The Philippine Eagle is classified as a
Critically Endangered species under the IUCN Red List, with a high end
estimated population of only 500 breeding pairs in the wild. Population decline has been attributed
to continuing deforestation, particularly since the mid-1900s, and
hunting. This study aimed to
identify the effects of population decline on the genetic structure of the present
population of the Philippine Eagle by sequencing 1132bp of the mitochondrial
control region from 22 individuals. Control region haplotype diversity (h = 0.8960±0.05590) and nucleotide
diversity (π = 0.006194±0.003372) are comparable with other accipitrid
species. Maximum likelihood trees
and network analysis show that the Luzon and Samar individuals come from
different lineages, but both shared a common ancestral population with the
Mindanao population. The genetic
diversity, multimodal mismatch distribution for the control region and high frequency
of lower class modes all indicate a recent bottleneck for the Philippine Eagle
population. Possible strategies for
conservation are discussed.
Keywords: Captive breeding,
Critically Endangered, genetic structure, mitochondrial control region, Pithecophaga
jefferyi, raptor species.
Abbreviations: CR - control region; DENR-BMB - Department of Environment and
Natural Resources-Biodiversity Management Bureau; H1-H12 - haplotypes 1 to 12
of the control region; ML tree - maximum likelihood tree; PCR - polymerase
chain reaction; PEF - Philippine Eagle Foundation; SNPs - single nucleotide
polymorphisms; UV-Etbr - Ultraviolet - Ethidium Bromide illumination.
doi: http://dx.doi.org/10.11609/JoTT.o3748.6335-44 | ZooBank: urn:lsid:zoobank.org:pub:FBCD6920-A726-412F-B106-72B2B834F990
Editor: C.
Srinivasulu, Osmania University, Hyderabad, India. Date of publication: 26 September 2014
(online & print)
Manuscript details: Ms #
o3748 | Received 14 August 2013 | Final received 19 May 2014 | Finally accepted
09 September 2014
Citation: Luczon,
A.U., I.K.C. Fontanilla, P.S. Ong, Z.U. Basiao, A.M.T. Sumaya & J.P.
Quilang (2014). Genetic diversity of the Critically Endangered Philippine EaglePithecophaga jefferyi (Aves: Accipitridae) and notes on its
conservation. Journal of Threatened Taxa 6(10): 6335–6344; http://dx.doi.org/10.11609/JoTT.o3748.6335-44
Copyright: © Luczon et al. 2014. Creative Commons Attribution
4.0 International License. JoTT allows unrestricted use of this article in any
medium, reproduction and distribution by providing adequate credit to the
authors and the source of publication.
Funding: We gratefully acknowledge the
following for providing funding for this study: University of the Philippines
Office of the Vice-President for Academic Affairs for the Emerging Science and
Technology Grant; the UP Diliman Chancellor through an Outright Research Grant
from the Office of the Vice Chancellor for Research and Development (111110
PNSE)
Competing Interest: The
authors declare no competing interests.
Author Contribution: Adrian U. Luczon was directly involved in
designing, undertaking the study and preparation of manuscript. Jonas P. Quilang was involved in
designing the study, preparation of manuscript and arrangement of funding. Anna Mae T. Sumaya was involved in
sampling. Dr. Ian Kendrich C. Fontanilla,
Dr. Perry S. Ong, and Dr. Zubaida
U. Basiao were involved in preparation of manuscript as well as
arrangement of funding.
Author Details: AUL is a recent graduate of MS Biology whose interest include conservation
of Philippine species using genetic tools like population genetics and
phylogenetics. IKCF is interested in molecular phylogeny and DNA barcoding of
species particularly in the field of Malacology. PSO is interested in
biodiversity conservation using ecological tools as well as DNA barcoding. ZUB
is interested in development of and improvement of cultured fish. AMTS is
interested in captive breeding and conservation of the Philippine Eagle and
other raptors. JPQ is interested in population genetics and DNA barcoding as
tools in conservation of marine and fresh water fish.
Acknowledgements: We
gratefully acknowledge the Energy Development Corporation and the Philippine
Eagle Foundation (PEF) and Department of Environment and Natural Resources - Bidiversity
Management Bureau for providing the samples used in this study.

For figures,
images, tables -- click here
Introduction
Family
Accipitridae includes eagles, kites, goshawks, hawk-eagles and Old World
vultures. The Philippine Eagle Pithecophaga
jefferyi is a diurnal raptor that was initially thought to be closely
related to large carnivorous birds of the subfamily Harpiinae, such as the
Harpy Eagle Harpia harpyja and the Crested Eagle Morphnus guianensis,
based on size and morphology (Peters 1931). However, genetic analysis revealed that
the Philippine Eagle is distinct from these species based on two mitochondrial
regions and a nuclear intron, and more closely related to smaller species of
snake-eagles of the subfamily Circaetinae (Lerner & Mindell 2005). The accipitrids are some of the most
endangered species of raptors, with dwindling numbers attributed to habitat
loss and other anthropogenic activities (Lerner & Mindell 2005). The Philippine Eagle is restricted to
only four islands in the Philippines: Luzon, Samar, Leyte and Mindanao (Rabor
1971; Kennedy 1977). These eagles
nest in tall trees usually in steep slopes near rivers and tributaries within
mature dipterocarp forests (Kennedy 1977), and the observation that they prey
on monkeys led to the common name Monkey-eating Eagle and the genus name Pithecophaga. Subsequent investigations revealed that
Philippine Eagles also prey on other vertebrates, including mammals, reptiles
and birds (Gamauf et al. 1998; Salvador & Ibanez 2006). These eagles have a breeding cycle that
lasts around two years, with one egg being laid at a time (Kennedy 1981). t
Philippine Eagle populations are continually being threatened by hunting and
loss of habitat (Kennedy 1977; BirdLife International 2013), and continuing
decrease in forest areas over the years has left this species under threat of
extinction. A recent study
estimated about 82-233 breeding pairs left in the wild in Mindanao and around
500 pairs throughout the Philippines (Bueser et al. 2003; Salvador & Ibanez
2006). IUCN classified these
raptors as Critically Endangered because of their unique breeding
characteristics and the unrelenting threats they face (Birdlife International
2013).
In
most cases a decrease in the population size will lead to a decrease in genetic
diversity. Low genetic diversity would normally increase the inbreeding rate,
which in turn would lead to the lowering of the population’s overall fitness
and increase the extinction risk (Brook et al. 2002). The assessment of genetic diversity
undertaken in this study will inform conservation actions for this species and
address problems associated with captive breeding programs already in place.
Materials
and Methods
Twenty-two
individuals were studied. Feather samples from two Luzon individuals and a
muscle sample from a Samar individual were provided by the Philippine
Department of Environment and Natural Resources-Biodiversity Management Bureau
(DENR-BMB). Blood samples from the
19 remaining individuals were provided by the Philippine Eagle Foundation (PEF)
from their captive breeding facility in Davao City, Mindanao Island. Blood extraction was performed via venipuncture
by a veterinarian during the annual medical check-up of the raptors; no animals
were harmed. Samples from PEF
consisted of 16 individuals originating from Mindanao forests and three
individuals bred in captivity, whose parents originated from Mindanao forests
as well (Table 1). Localities for
each Philippine Eagle included in the study are shown in Fig. 1.
DNA
from muscle samples was extracted using Wizard Genomic® DNA extraction kit
(Promega, USA) while feather and blood samples were extracted using DNeasy
Blood and Tissue Kit (Qiagen, USA) following manufacturers’ instructions.
The
complete mitochondrial CR (~1130bp) was amplified using two sets of PCR primers
designed with Primer3Plus (Untergasser et al. 2007) and with reference to the
complete mitochondrial genomes of Spilornis cheela (NC015887), Accipiter
gentilis (NC011818), Buteo buteo (NC003128) and Spizaetus
nipalensis (AP008238): a) 28v2f 5’-TGGTCTTGTAAACCAAAGACTGAA–3’ and
AULH28 5’–TCCTGAAGCTAGTAACATAGGACA–3’; b) LAUL30
5’–CGGACCAGGTTAGCTATTAGTCG–3’ and AUL30H
5’–GCGATTCGGGCYGTTTAG 3’. A 30µl PCR mix was prepared using components
from Taq DNTpack (Roche, USA). The mix consisted of 22.05µl of DNAse-free
water, 3µl PCR buffer (100 mM Tris–HCl, 15mM MgCl2, 500mM KCl,
pH 8.3 [20oC]), 0.6µl dNTP (10mM), 3µl of (1.5µl each) primer
(10mM), 0.15µl Taq polymerase (5 units/μl), and 1.2µl of genomic DNA
template.
PCR
conditions for the control region consisted of the following: an initial
denaturation of 94oC for three minutes; 35 cycles of 94oC
for one minute, 55oC for 1.5 minutes, and 72oC for 1.5
minutes; and a final extension of 72oC for five minutes. The PCR
products were run on a 1% agarose gel with ethidium bromide and the bands were
viewed under UV light.
Bands
from the gel that matched correctly with the expected size of the fragment were
excised and purified using Qiaquick® Gel Extraction Kit (Qiagen, USA),
following the manufacturer’s instructions. Purified PCR products were sent to 1stBASE in Selangor, Malaysia for
bidirectional sequencing.
Contigs
were assembled and primer sequences were removed using the STADEN package
Version 1.5.3 (Staden et al. 2000). Sequences were submitted to GenBank and were given accession numbers
(KC206370–KC206437). Sequences were aligned with BioEdit Sequence Alignment Editor Version
7.0.5.3 (Hall 1999) using the ClustalW algorithm. Unique haplotypes were determined using
the software DnaSP Version 5 (Librado & Rozas 2009).
To
visualize the relationships of the haplotypes, a maximum likelihood (ML) tree
and a median-joining network (Bandelt et al. 1999) were constructed. The ML
tree was generated using PhyML ver. 3.0 (Guindon & Gascuel 2003). The appropriate model for substitution
frequency was determined based on Bayesian Information Criterion in jModelTest
software (Posada 2008). The
median-joining network was constructed using NETWORK version 4.6
(http://www.fluxus-engineering.com).
Nucleotide
diversity (π) and haplotype diversity (h) were calculated in order to determine
the level of genetic diversity for the Philippine Eagle population. FST values were calculated in
order to estimate the degree of differentiation between the different
subpopulations. Analysis of
Molecular Variance (AMOVA) was used to test if sequence variances are concentrated
either between or within populations. Evidence for population expansion was evaluated using mismatch
distributions of pairwise differences, Fu’s FS (Fu 1997), Tajima’s D
(Tajima 1989) and Fu and Li’s F and DF (Fu & Li 1993). Fu’s FS uses the number of
haplotypes and average pairwise sequence divergence to test for presence of
demographic expansion (Fu 1997). Tajima’s D uses segregating sites average pair-wise sequence divergence
to test for departures from neutrality. Fu and Li’s DF and F use an outgroup sequence in order to
find recent mutations within the population which can be used as evidence for
population expansion (Fu & Li 1993). Negative values for these statistics indicate an excess of rare alleles
brought about by purifying selection or population expansion (Fu & Li
1993). Calculations for Fu and Li’s
DF and F were done in DnaSP v5. The rest of the analyses were done
using Arlequin suite version 3.5.1.2 (Excoffier & Lischer 2010). The complete mitochondrial CR of the
Crested Serpent-eagle (Spilornis cheela) (NC015887) was used as outgroup
for the construction of the ML tree.
Results
Of
22 samples analysed in this study, 14 unique control region haplotypes were
observed with haplotype 1 as the most frequent. Three unique haplotypes were represented
by each of the Luzon and Samar individuals, while the other 11 haplotypes were
found in the Mindanao samples. The
sequences varied by 36 sites, 23 indels and 13 substitutions, mostly found in
domain I of the CR. The average
pairwise percent difference between these haplotypes was 0.2813±0.01832 %. In the overall population, a high
haplotype diversity (h = 0.8960±0.05590) and low nucleotide diversity of (π =
0.006194±0.003372) were observed (Table 2).
The
ML tree is shown in Fig. 2. The Mindanao
haplotypes are split into three major branches, with each of the Luzon
haplotypes (H12=Isabela individual and H13=Cagayan individual) placed in a
different branch. The haplotype
from the Samar sample (H14) was most basal. However, all nodes have either a
low or moderate bootstrap support (less than 50%).
The
median-joining network generated is shown in Fig. 3. A cluster of Mindanao haplotypes (H1,
H2, H4, H5, H6, H9 and H10) form the torso of the network. The network shows that each of the Luzon
(H12 and H13) and Samar (H14) haplotypes stem from the torso on different
branches, although the Luzon haplotypes are closer to the cluster of Mindanao
haplotypes compared to the Samar haplotype. This may indicate that the Samar
individual came from a different phylogeographic origin from that of the Luzon
individuals.
Mismatch analysis was done
for the population and is shown in Fig. 4. Results for this analysis reveal a multimodal distribution. Test of goodness of fit was assessed
using the raggedness index where a non-significant value indicates a
non-significant difference between the observed and the simulated demographic
expansion model. Based on the
raggedness index for the test of goodness of fit of the observed data with
demographic expansion model, the Philippine Eagle population has undergone a
demographic expansion (r=0.02230, P-value=1.0000).
Tajima’s D test, Fu’s FStest and Fu and Li’s F or DF, however, contradict the mismatch
analysis and do not support demographic expansion. Results in these statistics contained
negative values; however, none of these values were significantly different
from zero (Table 3), thus population expansion is not supported. Tajima’s D and Fu’s FS are
known to be more sensitive than mismatch distributions in detecting populations
undergoing expansion (Fu 1997). Negative values of Tajima’s D and Fu’s F indicate an excess of single
substitutions brought about by population expansion. In addition, Fu and Li’s F and DFuse an outgroup sequence to test for evidence of population expansion and are
shown to be less sensitive to biases of small sample sizes (Fu & Li
1993). FST among
populations were generated (Table 4). All computed FST were positive. Based on Sewall Wright’s hierarchical F
statistics, these FST values indicated moderate to high genetic
difference between the subpopulations. However, only the FST for the overall population was
significant (P-value = 0.0401). Results from AMOVA showed that most of the variations of the control
region were found within populations (Table 5).
Discussion
and Conclusion
The
sample size for this study was 22 individuals. Breeding pairs in the wild could be at
most 500 (1000 individuals); however, this number may be an overestimate and it
may go down to around 350 breeding pairs. The actual numbers may even decrease further if we assume that only
around 40% of the habitat is used (Bueser et al. 2003). Nevertheless, the number of individuals
used in this study is a good sample for a Critically Endangered species such as
the Philippine Eagle (Images 1,2).
Genetic
diversity of the Accipitridae was summarized in Table 3 in the study of Lerner
et al. (2009). CR haplotype
diversity and nucleotide diversity observed from the Philippine Eagle was
comparable with values obtained from non-endangered raptors such as the Bearded
Vulture Gypaetus barbatus (h=0.932, π=0.0292, Godoy et al. 2004) and
White-tailed Eagle Haliaeetus albicilla (h=0.746, π=0.00680, Hailer et
al. 2007). Genetic diversity was
also comparable with other threatened raptor species such as the White-rumped
Vulture Gyps bengalensis (h=0.76, Johnson et al. 2008), Harpy Eagle
(h=0.906, π=0.0076, Lerner et al. 2009) and in the Red Kite Milvus milvus(h=0.610, π=0.0032, Roques & Negro 2005). These values were higher than some
raptors with stable populations such as in the White-bellied Sea Eagle Haliaeetus
leucogaster (h=0.350, π=0.000806, Shephard et al. 2005) and in Bonelli’s
Eagle Aquila fasciatus (h=0.542, π=0.00240, Cadahia et al. 2007). It should be noted that the Philippine
Eagle, in contrast to these taxa mentioned, is an island species whereas the
other raptors species inhabit huge distribution ranges.
High
haplotype diversities and low nucleotide diversities may indicate a population
bottleneck followed by demographic expansion (Grant & Bowen 1998). This, however, should not be used to
disprove a recent population bottleneck, since long-lived species have been
known to retain high genetic diversities even after experiencing a recent
bottleneck (Hailer et al. 2006). Fu
and Li’s F and DF, Tajima’s D, and Fu’s FS do not support
demographic expansion. In addition, the presence of high frequencies of lower
class modes (i.e., 0 and 3 nucleotide differences in the mismatch distribution)
is a pattern observed in simulations of populations that experienced a recent
bottleneck, although other factors can also contribute to this scenario (Rogers
& Harpending 1992; Lerner et al. 2009). Similar patterns of mismatch
distribution have been observed in some subpopulations of birds that
experienced a recent bottleneck (Harpy Eagles Harpia harpyja, Lerner et
al. 2009; Prairie Chickens Tympanuchus cupido, Johnson et al.
2007). Similarly, the Philippine
Eagle populations may have experienced a recent bottleneck.
One
possible bottleneck event for the Philippine Eagle population would be the
decrease in population attributed to a decrease in habitat over the years. In 1521, when the first Spanish
colonizers set foot in the Philippine archipelago, it was estimated that 90% of
the country’s land area was covered by forests, which decreased to around 71%
in 1900 because of the increase in human population and agricultural demands
(Environmental Science for Social Change 1999). In 1969 only an estimated 34.9% of
forest covered the total land area of the country. This was also the time when Rabor (1968)
warned the public about the declining population of the Philippine Eagle as
a result of persistent forest exploitation and hunting (Salvador & Ibanez
2006). In 2003, only 23.9%
(72,000km2) of forest cover remained (Forest Management Bureau
2011), of which less than 10,000km2 are considered primary forests
(Lasco et al. 2001).
Although
this bottleneck event is a possibility, there is a need to include additional
data to prove this. It is necessary
that data from other loci are evaluated to determine recent demographic changes
that could have occurred. Though it
is ideal to increase the sample size, this may prove difficult for the
Philippine Eagle because of constraints imposed by difficulty in sampling as
well as existing Philippine laws that prohibit such activities.
FSTindicates that the subpopulations are isolated from each other. On the other hand, AMOVA does not
support this and a clear division between Luzon, Samar and Mindanao haplotypes
were not observed in the MJ network and the ML tree. The MJ network seemed to indicate that
the unique haplotype of the Samar sample came from a different phylogeographic
origin from that of the Luzon samples, but both could have originated from
Mindanao haplotypes. However, since
the Philippine Eagle population of Luzon and Samar were underrepresented in
this study, this conclusion may be premature, as additional samples are
required to properly evaluate the scenario. Additional samples will also be needed
in order to properly evaluate the divergence of the subpopulations.
Historical
pattern of gene flow for the populations of the Philippine Eagle is also
lacking. For now, we can say that island populations may be isolated because,
despite current research efforts to monitor its population, documentation of
inter-island migrations for the species was not observed. In this respect, populations could have
solely dispersed during glaciation events as recent as the late Pleistocene
when the Greater Mindanao was formed (Brown & Diesmos 2001), or further
back as 11 million years ago when Mindanao was connected to Luzon (Hall
2002). Additional data is needed to
confirm this. Use of nuclear
markers such as microsatellites and single nucleotide polymorphisms (SNPs) on
nuclear loci may also provide a more accurate interpretation about historical
gene flow between island populations as well as give definitive answers about
the genetic bottleneck events.
As
mentioned, the high mitochondrial genetic diversity of raptors, including the
Philippine Eagle, could be related to its high longevity. The species has been
documented to live over 40 years in captivity, although persecution and habitat
loss may have shortened their lifespan in the wild. Long-lived eagles such as
the White-tailed eagle Haliaeetus albicilla (Hailer et al. 2006),
White-rumped vulture G. bengalensis (Johnson et al. 2008) and Harpy
eagle H. harpyja (Lerner et al. 2009), similarly, have high
mitochondrial genetic diversity. Species with a long lifespan can buffer
against genetic diversity loss because of a large pool of juveniles that are
more resilient to disturbances in the environment than adults (Kuo & Janzen
2004). However, as Johnson et al.
(2008) pointed out, long lived species can only buffer against genetic
diversity loss if pressures against their population number will last only for
short periods of time. Prolonged
low population numbers will eventually decrease the species’ genetic diversity.
Conservation
of threatened but genetically diverse species should include ways to maintain
genetic diversity in the populations in the wild. One approach is to focus on protecting
and ensuring the survival of wild populations in local nest sites. For example,
conservation programs in Central Europe increased the survival of H.
albicilla populations by locating and protecting nests. During winter, they
also leave uncontaminated carcasses for the eagles to feed on. It is believed that this practice led to
the maintenance of the species’ genetic diversity (Hailer et al. 2006).
This
conservation practice on ensuring the survival of the juveniles can be applied
to the Mindanao Philippine Eagle population in order to maintain its degree of
genetic diversity. In the conservation
of Philippine Eagles in Mindanao, local government and communities play a
substantive role in undertaking this conservation practice if nests have been
identified within their area. Current conservation efforts for the Philippine Eagle are primarily led
by the Philippine Eagle Foundation since its establishment in 1987 through
captive breeding and reintroduction to the wild of juveniles and rehabilitated
individuals from where they were collected (Salvador & Ibanez 2006). One program of PEF that conforms to the
aforementioned conservation practice is the “adopt-a-nest” program where
participants are enlisted to monitor and report back to PEF personnel about the
breeding status within the nest. As such, this program should be given emphasis
by conservationists and the Philippine government. In addition, several laws,
such as the Republic Act 9147: Wildlife Resources Conservation and Protection
Act, were enacted to protect the remaining populations of the Philippine Eagle
as well as to promote its conservation.
It
should be clear that although this study observed a high genetic diversity for
the remaining population of the Philippine Eagle (with focus on the Mindanao
population), this does not exempt this species from the danger of extinction as
long as the main threats to this species, such as habitat destruction and
hunting, remain. Caution must also be exercised when observing patterns for
high genetic diversity in populations that have undergone a recent bottleneck
since this could mask high rates of genetic drift (Kuo & Janzen 2004). The main objective of captive breeding
programs is for increasing the population of an endangered species for later
introduction or reintroduction. It is undisputedly an expensive way to save a
species such as the Philippine Eagle, not to mention other criticisms against
captive breeding such as increase in inbreeding rate and genetic adaptation to
captivity as discussed by Frankham (2008). However, with proper management of breeding individuals (Frankham 2008)
and addition of individuals from the wild (Johnson et al. 2008), these problems
can be prevented. Nevertheless,
success of captive breeding programs can only be realized if captive bred
individuals can survive and reproduce in the wild upon release. That is why it is still essential to
ensure, for the Philippine Eagle, that a good range of high quality habitat is
maintained and prohibiting hunting is enforced. Successes in restoring population
numbers have been observed in Bald Eagles Haliaeetus leucocephalus and
Peregrine Falcon Falco peregrinus (www.fws.gov).
If
Philippine Eagle protection and habitat quality maintenance are properly
executed, it will also result in the protection of other species that fall
within the protected area (Salvador & Ibanez 2006). Recently, the
Philippine government, through the DENR-BMB, has provided additional support to
stem the tide of extinction of the Philippine Eagle. More support from other
institutions will definitely increase the effectiveness of these conservation efforts
and eventually reverse the trend of extinction the Philippine Eagle is facing.
This
study demonstrates the current genetic characteristics of the Philippine Eagle
population. It is not possible to fully evaluate the genetic differentiation
between island populations at this time because of low number of individuals,
included for the study, from the islands of Luzon and Samar. Mismatch analysis
indicate a genetic bottleneck that could have coincided with the rapid loss of
forests in the mid-1900s. The
Philippine Eagle showed comparable genetic diversity with other members of the
family Accipitridae despite experiencing population decline. However, continued low population
numbers may inevitably lead to a decrease in genetic diversity. Within the PEF,
additional individuals may be needed in order to maintain the genetic diversity
of the Philippine Eagle population within the captive breeding area. As a means to increase or maintain the
genetic diversity of population in the wild, conservation efforts should focus
on increasing juvenile survival.
For
future studies, it is recommended that the sample size of the Luzon and Samar
population be increased so that more haplotypes may be identified and can be
used to determine the direction of migration of the Philippine Eagle and to be
able to estimate genetic differentiation between populations. Information from this will help
determine if introduction of individuals from Mindanao to the other islands is
advisable. Museum specimens may also be used to increase the number of
individuals. Other sensitive
markers such as microsatellites and single nucleotide polymorphisms (SNPs) may
also be used in order to be able to assess the genetic diversity of the nuclear
loci.
References
Bandelt, H.J., P. Forster & A. Rohl (1999).
Median-joining networks for inferring intraspecific phylogenies. Molecular
Biology and Evolution 16: 37-48.
BirdLife International (2013). Pithecophaga jefferyi. The IUCN Red List of
Threatened Species. Version 2014.2. <www.iucnredlist.org>. Downloaded on
16 September 2014.
Brook, B.W., D.W. Tonkyn, J.J. O’Grady & R. Frankham (2002). Contirbution of inbreeding
to extinction risk in threatened species. Conservation Ecology 6(1): 16.
Brown, R.M. & A. Diesmos (2001). Application of lineage-based
species concepts to Oceanic Island Frog populations: the effects of differing
taxonomic philosophies on the estimation of Philippine biodiversity. Silliman
Journal 42: 133–162.
Bueser, G., K. Bueser, D. Afan, D. Salvador, J. Grier, R. Kennery
& H. Miranda (2003). Distribution and nesting density of the Philippine Eagle Pithecophaga
jefferyi on Mindanao Island, Philippines: what do we know after 100 years? Ibis145: 1–130.
Cadahia, L., J.J. Negro & U. Vicente (2007). Low mitochondrial DNA
diversity in the endangered Bonelli’s Eagle (Hieraaetus fasciatus)
from SW Europe (Iberia) and NW Africa. Journal of Ornithology 148:
99–104; http://dx.doi.org/10.1007/s10336-006-0107-z
Environmental Science for Social Change (1999). Decline of the Philippine
Forests. ESSC, Inc., Quezon City, Philippines, 1+43pp.
Excoffier, L. & H.E.L. Lischer (2010). Arlequin suite ver. 3.5: A
new series of programs to perform population genetics analyses under Linux and
Windows. Molecular Ecology Resources 10: 564–567; http://dx.doi.org/10.1111/j.1755-0998.2010.02847.x
Fluxus Engineering (2011). Network version 4.6.1.0.Available at http://www.fluxus-engineering.com.
On-line version dated 22 October 2011.
Forest Management Bureau (2011). Philippine Forestry Statistics. Forest
Economics Division, Quezon City, Philippines, v+291pp.
Frankham, R. (2008). Genetic adaptation to captivity in species conservation programs.Molecular Ecology 17: 325–333; http://dx.doi.org/10.1111/j.1365-294X.2007.03399.x
Fu, Y.X. (1997) Statistical tests of neutrality of mutations against population
growth, hitchhiking and background selection. Genetics 147:915-925.
Fu, Y.X. & W.H. Li (1993). Statistical tests of neutrality of mutations. Genetics133: 693–709.
Gamauf, A., M. Preleuthner, M. Preleuthner & H. Winkler
(1998).Philippine birds of prey: interrelations among habitat, morphology, and
behavior. The Auk 115(3): 713–726.
Godoy, J.A., J.J. Negro, F. Hiraldo & J.A. Donazar (2004). Phylogeography, genetic
structure and diversity in the endangered Bearded Vulture (Gypaetus barbatus,
L.) as revealed by mitochondrial DNA. Molecular Ecology 13:
371–390; http://dx.doi.org/10.1046/j.1365-294X.2003.02075.x
Grant, W.S. & B.W. Bowen (1998). Shallow population histories
in deep evolutionary lineages of marine fishes: Insights from sardines and
anchovies and lessons for conservation. Journal of Heredity 89:
415–426; http://dx.doi.org/10.1093/jhered/89.5.415
Guindon, S. & O. Gascuel (2003). A simple, fast and accurate
algorithm to estimate large phylogenies by maximum likelihood. Systematic
Biology 52(5): 696–704; http://dx.doi.org/10.1080/10635150390235520
Hailer, F., B. Helander, A.O. Folkestad, S.A. Ganusevich, S.
Garstad, P. Hauff, C. Koren, T. Nygard, V. Volke, C. Vila & H. Ellegren
(2006).Bottlenecked but long-lived: high genetic diversity retained in White-tailed
Eagles upon recovery from population decline. Biology Letters 2:
316–319; http://dx.doi.org/10.1098/rsbl.2006.0453
Hailer, F., B. Helander, A.O. Folkestad, S.A. Ganusevich, S.
Garstad, P. Hauff, C. Koren, V.B. Masterov, T. Nygard, J.A. Rudnick, S.
Shiraki, K. Skarphedinsson, V. Volke, F. Wille & C. Vila (2007). Phylogeography of the
White-tailed Eagle, a generalist with large dispersal capacity. Journal of
Biogeography 34(7): 1193–1206; http://dx.doi.org/10.1111/j.1365-2699.2007.01697.x
Hall, R. (2002). Cenozoic geological and plate tectonic evolution of SE Asia and
the SW Pacific: computer-based reconstructions, model and animations. Journal
of Asian Earth Science 353-431; http://dx.doi.org/10.1016/S1367-9120(01)00069-4
Hall, T. (1999). Bioedit: a user-friendly biological sequence alignment editor and
analysis program for Windows 95/98/NT. Nucleic Acid Symposium 41:
95–98.
Johnson, J.A., P.O. Dunn & J.L. Bouzat (2007). Effects of recent population
bottlenecks on reconstructing the demographic history of prairie-chickens. Molecular
Ecology 16: 2203–2222; http://dx.doi.org/10.1111/j.1365-294X.2007.03285.x
Johnson, J.A., M. Gilbert, M.Z. Virani, M. Asim & D.P. Mindell
(2008).Temporal genetic analysis of the critically endangered Oriental White-backed
Vulture in Pakistan. Biological Conservation 141(9): 2403–2409; http://dx.doi.org/10.1016/j.biocon.2008.07.001
Kennedy, R.S. (1977). Notes on the biology and population status of the monkey-eating
eagle of the Philippines. Wilson Bulletin 89(1): 1–192.
Kennedy, R.S. (1981). The air’s noblest flier. Filipinas Journal of Science and
Culture 2: 33–48.
Kuo, C.H. & F.J. Janzen (2004). Genetic effects of a
persistent bottleneck on a natural population of ornate box turtles (Terrapene
ornata). Conservation Genetics 5: 425–437; http://dx.doi.org/10.1023/B:COGE.0000041020.54140.45
Lasco, R.D., R.G. Visco & J.M. Pulhin (2001). Secondary Forests in the
Philippines: Formation and Transformation in the 20th Century. Journal
of Tropical Forest Science 13: 652–670.
Lerner, H.R.L., J.A. Johnson, A.R. Lindsay, L.F. Kiff & D.P.
Mindell (2009). It’s not too late for the Harpy Eagle (Harpia harpyja):
high levels fo genetic diversity and differentiation can fuel conservation
programs. Public Library of Science One 4(10): e7336; http://dx.doi.org/10.1371/journal.pone.0007336
Lerner, H.R.L. & D.P. Mindell (2005). Phylogeny of eagles, Old
World Vultures, and other Accipitridae based on nuclear and mitochondrial DNA. Molecular
Phylogenetics and Evolution 37: 327–346; http://dx.doi.org/10.1016/j.ympev.2005.04.010
Librado, P. & J. Rozas (2009). DnaSP v5: a software for
comprehensive analysis of DNA polymorphism data. Bioinformatics 25:
1451–1452; http://dx.doi.org/10.1093/bioinformatics/btp187
Peters, J.L. (1931). Check-list of the birds of the world. Vol. 1. Cambridge: Harvard
University Press.
Posada, D. (2008). jModelTest: phylogenetic model averaging. Molecular Biology
and Evolution 25: 1253–1256; http://dx.doi.org/10.1093/molbev/msn083
Rabor, D.S. (1971). The present status of the conservation of the Monkey-eating Eagle
of the Philippines. Philippine Geography Journal 15: 90–103.
Rogers, A.R. & H. Harpending (1992). Population growth makes
waves in the distribution of pairwise genetic differences. Molecular Biology
and Evolution 9(3): 552–569.
Roques, S. & J.J. Negro (2005). MtDNA genetic diversity and
population history of a dwindling raptorial bird, the red kite (Milvus
milvus). Biological Conservation 126: 41–50; http://dx.doi.org/10.1016/j.biocon.2005.04.020
Salvador, D.J. & J.C. Ibanez (2006). Ecology and conservation of
Philippine Eagles. Ornithological Science 5: 171–176.
Shephard, J.M., H.M. Hughes, C.P. Catterall & P.D. Olsen
(2005).Conservation status of the White-bellied Sea-Eagle Haliaeetus leucogasterin Australia determined using mtDNA control region. Conservation Genetics6: 413–429.
Staden, R.K., K.F. Beal & J.K. Bonfield (2000). The Staden package, 1998. Methods
in Molecular Biology 132: 115–130.
Tajima, F. (1989). Statistical method for testing the neutral mutational hypothesis
by DNA polymeration. Genetics 123: 585–595.
Untergasser, A., H. Nijveen, X. Rao, T. Bisseling, R. Geurts &
J.A.M. Leunissen (2007). Primer3Plus, an enhanced web interface to Primer3. Nucleic
Acids Research 35: W71–W74; http://dx.doi.org/10.1093/nar/gkm306
US Fish and Wildlife Service (2013). www.fws.gov. On-line version
dated 12 March 2013.